ID: 939404340

View in Genome Browser
Species Human (GRCh38)
Location 2:141736553-141736575
Sequence TGGTAGCCCCAAGCACACCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939404340_939404342 23 Left 939404340 2:141736553-141736575 CCAAGGTGTGCTTGGGGCTACCA No data
Right 939404342 2:141736599-141736621 TTAAGCCACCCAATGTGTAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939404340 Original CRISPR TGGTAGCCCCAAGCACACCT TGG (reversed) Intronic