ID: 939414426

View in Genome Browser
Species Human (GRCh38)
Location 2:141875699-141875721
Sequence AAATATAGACTACCCTTGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939414426_939414430 -3 Left 939414426 2:141875699-141875721 CCCCACAAGGGTAGTCTATATTT No data
Right 939414430 2:141875719-141875741 TTTGAGTTCATGGAGAAGTCTGG No data
939414426_939414431 2 Left 939414426 2:141875699-141875721 CCCCACAAGGGTAGTCTATATTT No data
Right 939414431 2:141875724-141875746 GTTCATGGAGAAGTCTGGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939414426 Original CRISPR AAATATAGACTACCCTTGTG GGG (reversed) Intronic
No off target data available for this crispr