ID: 939418153

View in Genome Browser
Species Human (GRCh38)
Location 2:141928075-141928097
Sequence CATTCTCCCCAAAGTGTAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939418148_939418153 30 Left 939418148 2:141928022-141928044 CCTGTTTACAGCTGTCTATGTTC No data
Right 939418153 2:141928075-141928097 CATTCTCCCCAAAGTGTAGTGGG No data
939418151_939418153 -1 Left 939418151 2:141928053-141928075 CCAGTAGGGCTATGCTGTCATTC No data
Right 939418153 2:141928075-141928097 CATTCTCCCCAAAGTGTAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939418153 Original CRISPR CATTCTCCCCAAAGTGTAGT GGG Intronic
No off target data available for this crispr