ID: 939422579

View in Genome Browser
Species Human (GRCh38)
Location 2:141992890-141992912
Sequence TGCTGAAATTACAGTGATTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939422579_939422584 29 Left 939422579 2:141992890-141992912 CCTAAATCACTGTAATTTCAGCA No data
Right 939422584 2:141992942-141992964 TTTACTTGACAGGCATTGCTGGG No data
939422579_939422583 28 Left 939422579 2:141992890-141992912 CCTAAATCACTGTAATTTCAGCA No data
Right 939422583 2:141992941-141992963 TTTTACTTGACAGGCATTGCTGG No data
939422579_939422581 19 Left 939422579 2:141992890-141992912 CCTAAATCACTGTAATTTCAGCA No data
Right 939422581 2:141992932-141992954 AACCGTATGTTTTACTTGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939422579 Original CRISPR TGCTGAAATTACAGTGATTT AGG (reversed) Intronic
No off target data available for this crispr