ID: 939423407

View in Genome Browser
Species Human (GRCh38)
Location 2:142003324-142003346
Sequence ATTTGCACAAAATTACCCAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939423407_939423409 2 Left 939423407 2:142003324-142003346 CCAATGGGTAATTTTGTGCAAAT No data
Right 939423409 2:142003349-142003371 GAAAAATGCACTTCCTACAAGGG No data
939423407_939423414 24 Left 939423407 2:142003324-142003346 CCAATGGGTAATTTTGTGCAAAT No data
Right 939423414 2:142003371-142003393 GACCTACAGTCTTTTGGGCTGGG No data
939423407_939423411 18 Left 939423407 2:142003324-142003346 CCAATGGGTAATTTTGTGCAAAT No data
Right 939423411 2:142003365-142003387 ACAAGGGACCTACAGTCTTTTGG No data
939423407_939423417 30 Left 939423407 2:142003324-142003346 CCAATGGGTAATTTTGTGCAAAT No data
Right 939423417 2:142003377-142003399 CAGTCTTTTGGGCTGGGGATTGG No data
939423407_939423415 25 Left 939423407 2:142003324-142003346 CCAATGGGTAATTTTGTGCAAAT No data
Right 939423415 2:142003372-142003394 ACCTACAGTCTTTTGGGCTGGGG No data
939423407_939423408 1 Left 939423407 2:142003324-142003346 CCAATGGGTAATTTTGTGCAAAT No data
Right 939423408 2:142003348-142003370 AGAAAAATGCACTTCCTACAAGG No data
939423407_939423412 19 Left 939423407 2:142003324-142003346 CCAATGGGTAATTTTGTGCAAAT No data
Right 939423412 2:142003366-142003388 CAAGGGACCTACAGTCTTTTGGG No data
939423407_939423413 23 Left 939423407 2:142003324-142003346 CCAATGGGTAATTTTGTGCAAAT No data
Right 939423413 2:142003370-142003392 GGACCTACAGTCTTTTGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939423407 Original CRISPR ATTTGCACAAAATTACCCAT TGG (reversed) Intronic
No off target data available for this crispr