ID: 939427945

View in Genome Browser
Species Human (GRCh38)
Location 2:142065078-142065100
Sequence ATGAAACTCTACCACAGACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939427945_939427946 19 Left 939427945 2:142065078-142065100 CCATGTCTGTGGTAGAGTTTCAT No data
Right 939427946 2:142065120-142065142 ATATAACTATCCCTTTAAGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939427945 Original CRISPR ATGAAACTCTACCACAGACA TGG (reversed) Intronic
No off target data available for this crispr