ID: 939431259 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 2:142111470-142111492 |
Sequence | TAGGAAGCAAAACATGATCA TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
939431258_939431259 | -8 | Left | 939431258 | 2:142111455-142111477 | CCTTGCATTCAAGTATAGGAAGC | No data | ||
Right | 939431259 | 2:142111470-142111492 | TAGGAAGCAAAACATGATCATGG | No data | ||||
939431256_939431259 | 11 | Left | 939431256 | 2:142111436-142111458 | CCTGCGCATACATTTCTCTCCTT | No data | ||
Right | 939431259 | 2:142111470-142111492 | TAGGAAGCAAAACATGATCATGG | No data | ||||
939431255_939431259 | 18 | Left | 939431255 | 2:142111429-142111451 | CCTGGATCCTGCGCATACATTTC | No data | ||
Right | 939431259 | 2:142111470-142111492 | TAGGAAGCAAAACATGATCATGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
939431259 | Original CRISPR | TAGGAAGCAAAACATGATCA TGG | Intronic | ||
No off target data available for this crispr |