ID: 939431259

View in Genome Browser
Species Human (GRCh38)
Location 2:142111470-142111492
Sequence TAGGAAGCAAAACATGATCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939431258_939431259 -8 Left 939431258 2:142111455-142111477 CCTTGCATTCAAGTATAGGAAGC No data
Right 939431259 2:142111470-142111492 TAGGAAGCAAAACATGATCATGG No data
939431256_939431259 11 Left 939431256 2:142111436-142111458 CCTGCGCATACATTTCTCTCCTT No data
Right 939431259 2:142111470-142111492 TAGGAAGCAAAACATGATCATGG No data
939431255_939431259 18 Left 939431255 2:142111429-142111451 CCTGGATCCTGCGCATACATTTC No data
Right 939431259 2:142111470-142111492 TAGGAAGCAAAACATGATCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939431259 Original CRISPR TAGGAAGCAAAACATGATCA TGG Intronic
No off target data available for this crispr