ID: 939432627

View in Genome Browser
Species Human (GRCh38)
Location 2:142130643-142130665
Sequence CTTACCTCGGTCGGCTCCCA CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 54
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 52}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939432612_939432627 27 Left 939432612 2:142130593-142130615 CCAGCAGGAAAGCCAAGGAAGTC 0: 1
1: 0
2: 0
3: 22
4: 176
Right 939432627 2:142130643-142130665 CTTACCTCGGTCGGCTCCCACGG 0: 1
1: 0
2: 0
3: 1
4: 52
939432611_939432627 28 Left 939432611 2:142130592-142130614 CCCAGCAGGAAAGCCAAGGAAGT 0: 1
1: 1
2: 4
3: 37
4: 239
Right 939432627 2:142130643-142130665 CTTACCTCGGTCGGCTCCCACGG 0: 1
1: 0
2: 0
3: 1
4: 52
939432619_939432627 15 Left 939432619 2:142130605-142130627 CCAAGGAAGTCAGGGGAGGGGAG 0: 1
1: 1
2: 3
3: 55
4: 508
Right 939432627 2:142130643-142130665 CTTACCTCGGTCGGCTCCCACGG 0: 1
1: 0
2: 0
3: 1
4: 52

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939432627 Original CRISPR CTTACCTCGGTCGGCTCCCA CGG Exonic