ID: 939437497

View in Genome Browser
Species Human (GRCh38)
Location 2:142197537-142197559
Sequence CAATTGATTGAGAGGGTGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939437494_939437497 -9 Left 939437494 2:142197523-142197545 CCTTCTAGGAGAGACAATTGATT No data
Right 939437497 2:142197537-142197559 CAATTGATTGAGAGGGTGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939437497 Original CRISPR CAATTGATTGAGAGGGTGCA TGG Intergenic
No off target data available for this crispr