ID: 939440300

View in Genome Browser
Species Human (GRCh38)
Location 2:142240019-142240041
Sequence GGGAACAACATGAGGACTAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939440295_939440300 19 Left 939440295 2:142239977-142239999 CCCAAGCTGCAGATATGTAAGAT No data
Right 939440300 2:142240019-142240041 GGGAACAACATGAGGACTATAGG No data
939440296_939440300 18 Left 939440296 2:142239978-142240000 CCAAGCTGCAGATATGTAAGATA No data
Right 939440300 2:142240019-142240041 GGGAACAACATGAGGACTATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939440300 Original CRISPR GGGAACAACATGAGGACTAT AGG Intergenic
No off target data available for this crispr