ID: 939441254

View in Genome Browser
Species Human (GRCh38)
Location 2:142253138-142253160
Sequence TTGTTGTTGTTGTTGAAACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939441254_939441260 26 Left 939441254 2:142253138-142253160 CCCTGTTTCAACAACAACAACAA No data
Right 939441260 2:142253187-142253209 GCCTATAGGCCCAGCTACCAAGG No data
939441254_939441257 -5 Left 939441254 2:142253138-142253160 CCCTGTTTCAACAACAACAACAA No data
Right 939441257 2:142253156-142253178 AACAACAAAATAGTTGGCTGTGG No data
939441254_939441258 -2 Left 939441254 2:142253138-142253160 CCCTGTTTCAACAACAACAACAA No data
Right 939441258 2:142253159-142253181 AACAAAATAGTTGGCTGTGGTGG No data
939441254_939441259 12 Left 939441254 2:142253138-142253160 CCCTGTTTCAACAACAACAACAA No data
Right 939441259 2:142253173-142253195 CTGTGGTGGTGTGTGCCTATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939441254 Original CRISPR TTGTTGTTGTTGTTGAAACA GGG (reversed) Intergenic
No off target data available for this crispr