ID: 939441258

View in Genome Browser
Species Human (GRCh38)
Location 2:142253159-142253181
Sequence AACAAAATAGTTGGCTGTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939441255_939441258 -3 Left 939441255 2:142253139-142253161 CCTGTTTCAACAACAACAACAAC No data
Right 939441258 2:142253159-142253181 AACAAAATAGTTGGCTGTGGTGG No data
939441253_939441258 -1 Left 939441253 2:142253137-142253159 CCCCTGTTTCAACAACAACAACA No data
Right 939441258 2:142253159-142253181 AACAAAATAGTTGGCTGTGGTGG No data
939441254_939441258 -2 Left 939441254 2:142253138-142253160 CCCTGTTTCAACAACAACAACAA No data
Right 939441258 2:142253159-142253181 AACAAAATAGTTGGCTGTGGTGG No data
939441251_939441258 22 Left 939441251 2:142253114-142253136 CCAGCCTGGGCAATATAGCAAGA 0: 654
1: 8511
2: 44891
3: 111518
4: 220468
Right 939441258 2:142253159-142253181 AACAAAATAGTTGGCTGTGGTGG No data
939441252_939441258 18 Left 939441252 2:142253118-142253140 CCTGGGCAATATAGCAAGACCCC 0: 268
1: 3334
2: 12953
3: 47308
4: 116579
Right 939441258 2:142253159-142253181 AACAAAATAGTTGGCTGTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939441258 Original CRISPR AACAAAATAGTTGGCTGTGG TGG Intergenic
No off target data available for this crispr