ID: 939441259

View in Genome Browser
Species Human (GRCh38)
Location 2:142253173-142253195
Sequence CTGTGGTGGTGTGTGCCTAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939441255_939441259 11 Left 939441255 2:142253139-142253161 CCTGTTTCAACAACAACAACAAC No data
Right 939441259 2:142253173-142253195 CTGTGGTGGTGTGTGCCTATAGG No data
939441254_939441259 12 Left 939441254 2:142253138-142253160 CCCTGTTTCAACAACAACAACAA No data
Right 939441259 2:142253173-142253195 CTGTGGTGGTGTGTGCCTATAGG No data
939441253_939441259 13 Left 939441253 2:142253137-142253159 CCCCTGTTTCAACAACAACAACA No data
Right 939441259 2:142253173-142253195 CTGTGGTGGTGTGTGCCTATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939441259 Original CRISPR CTGTGGTGGTGTGTGCCTAT AGG Intergenic
No off target data available for this crispr