ID: 939441260

View in Genome Browser
Species Human (GRCh38)
Location 2:142253187-142253209
Sequence GCCTATAGGCCCAGCTACCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939441254_939441260 26 Left 939441254 2:142253138-142253160 CCCTGTTTCAACAACAACAACAA No data
Right 939441260 2:142253187-142253209 GCCTATAGGCCCAGCTACCAAGG No data
939441253_939441260 27 Left 939441253 2:142253137-142253159 CCCCTGTTTCAACAACAACAACA No data
Right 939441260 2:142253187-142253209 GCCTATAGGCCCAGCTACCAAGG No data
939441255_939441260 25 Left 939441255 2:142253139-142253161 CCTGTTTCAACAACAACAACAAC No data
Right 939441260 2:142253187-142253209 GCCTATAGGCCCAGCTACCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939441260 Original CRISPR GCCTATAGGCCCAGCTACCA AGG Intergenic
No off target data available for this crispr