ID: 939456703

View in Genome Browser
Species Human (GRCh38)
Location 2:142446368-142446390
Sequence TGGAACAATAGGAGCACTAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939456699_939456703 14 Left 939456699 2:142446331-142446353 CCAGTACTGAGTAGAAGAATGAA No data
Right 939456703 2:142446368-142446390 TGGAACAATAGGAGCACTAAGGG No data
939456698_939456703 15 Left 939456698 2:142446330-142446352 CCCAGTACTGAGTAGAAGAATGA No data
Right 939456703 2:142446368-142446390 TGGAACAATAGGAGCACTAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939456703 Original CRISPR TGGAACAATAGGAGCACTAA GGG Intergenic
No off target data available for this crispr