ID: 939459159

View in Genome Browser
Species Human (GRCh38)
Location 2:142476769-142476791
Sequence ATGAAGAAGCAGATTTAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939459159_939459163 17 Left 939459159 2:142476769-142476791 CCAGCCTAAATCTGCTTCTTCAT No data
Right 939459163 2:142476809-142476831 TGTATTACTTTATAAATCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939459159 Original CRISPR ATGAAGAAGCAGATTTAGGC TGG (reversed) Intergenic
No off target data available for this crispr