ID: 939464871

View in Genome Browser
Species Human (GRCh38)
Location 2:142544368-142544390
Sequence CTGTAGGTACGGTGGGAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939464871_939464878 -5 Left 939464871 2:142544368-142544390 CCTGCTTCCCACCGTACCTACAG No data
Right 939464878 2:142544386-142544408 TACAGCAGCCCTCTAGCCTGGGG No data
939464871_939464884 16 Left 939464871 2:142544368-142544390 CCTGCTTCCCACCGTACCTACAG No data
Right 939464884 2:142544407-142544429 GGGCGCTTGTTAGAGTAGATGGG No data
939464871_939464883 15 Left 939464871 2:142544368-142544390 CCTGCTTCCCACCGTACCTACAG No data
Right 939464883 2:142544406-142544428 GGGGCGCTTGTTAGAGTAGATGG No data
939464871_939464876 -7 Left 939464871 2:142544368-142544390 CCTGCTTCCCACCGTACCTACAG No data
Right 939464876 2:142544384-142544406 CCTACAGCAGCCCTCTAGCCTGG No data
939464871_939464877 -6 Left 939464871 2:142544368-142544390 CCTGCTTCCCACCGTACCTACAG No data
Right 939464877 2:142544385-142544407 CTACAGCAGCCCTCTAGCCTGGG No data
939464871_939464879 -4 Left 939464871 2:142544368-142544390 CCTGCTTCCCACCGTACCTACAG No data
Right 939464879 2:142544387-142544409 ACAGCAGCCCTCTAGCCTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939464871 Original CRISPR CTGTAGGTACGGTGGGAAGC AGG (reversed) Intergenic
No off target data available for this crispr