ID: 939467551

View in Genome Browser
Species Human (GRCh38)
Location 2:142578404-142578426
Sequence ATGAAGAAGCCAAAGGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939467551_939467557 16 Left 939467551 2:142578404-142578426 CCATCCTCCTTTGGCTTCTTCAT No data
Right 939467557 2:142578443-142578465 ATTTACTCCAGTAAATCTCTTGG No data
939467551_939467554 -8 Left 939467551 2:142578404-142578426 CCATCCTCCTTTGGCTTCTTCAT No data
Right 939467554 2:142578419-142578441 TTCTTCATTCTTTTCCCTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939467551 Original CRISPR ATGAAGAAGCCAAAGGAGGA TGG (reversed) Intergenic
No off target data available for this crispr