ID: 939467554

View in Genome Browser
Species Human (GRCh38)
Location 2:142578419-142578441
Sequence TTCTTCATTCTTTTCCCTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939467548_939467554 18 Left 939467548 2:142578378-142578400 CCCTACATCACAAACTGATAGTT No data
Right 939467554 2:142578419-142578441 TTCTTCATTCTTTTCCCTCATGG No data
939467549_939467554 17 Left 939467549 2:142578379-142578401 CCTACATCACAAACTGATAGTTT No data
Right 939467554 2:142578419-142578441 TTCTTCATTCTTTTCCCTCATGG No data
939467551_939467554 -8 Left 939467551 2:142578404-142578426 CCATCCTCCTTTGGCTTCTTCAT No data
Right 939467554 2:142578419-142578441 TTCTTCATTCTTTTCCCTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939467554 Original CRISPR TTCTTCATTCTTTTCCCTCA TGG Intergenic
No off target data available for this crispr