ID: 939467557

View in Genome Browser
Species Human (GRCh38)
Location 2:142578443-142578465
Sequence ATTTACTCCAGTAAATCTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939467553_939467557 9 Left 939467553 2:142578411-142578433 CCTTTGGCTTCTTCATTCTTTTC No data
Right 939467557 2:142578443-142578465 ATTTACTCCAGTAAATCTCTTGG No data
939467551_939467557 16 Left 939467551 2:142578404-142578426 CCATCCTCCTTTGGCTTCTTCAT No data
Right 939467557 2:142578443-142578465 ATTTACTCCAGTAAATCTCTTGG No data
939467552_939467557 12 Left 939467552 2:142578408-142578430 CCTCCTTTGGCTTCTTCATTCTT No data
Right 939467557 2:142578443-142578465 ATTTACTCCAGTAAATCTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939467557 Original CRISPR ATTTACTCCAGTAAATCTCT TGG Intergenic
No off target data available for this crispr