ID: 939468064

View in Genome Browser
Species Human (GRCh38)
Location 2:142583763-142583785
Sequence GACTCGTATTTTTAGCATCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939468063_939468064 -4 Left 939468063 2:142583744-142583766 CCTTTCACACAATTGGCAAGACT No data
Right 939468064 2:142583763-142583785 GACTCGTATTTTTAGCATCTTGG No data
939468061_939468064 16 Left 939468061 2:142583724-142583746 CCACTGTATACTTTATGTTGCCT No data
Right 939468064 2:142583763-142583785 GACTCGTATTTTTAGCATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939468064 Original CRISPR GACTCGTATTTTTAGCATCT TGG Intergenic
No off target data available for this crispr