ID: 939468552

View in Genome Browser
Species Human (GRCh38)
Location 2:142589683-142589705
Sequence CACATTCAGCAACTAGAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939468549_939468552 27 Left 939468549 2:142589633-142589655 CCCGCAAGGAAATGGAAGCATAG No data
Right 939468552 2:142589683-142589705 CACATTCAGCAACTAGAGCTGGG No data
939468550_939468552 26 Left 939468550 2:142589634-142589656 CCGCAAGGAAATGGAAGCATAGA No data
Right 939468552 2:142589683-142589705 CACATTCAGCAACTAGAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939468552 Original CRISPR CACATTCAGCAACTAGAGCT GGG Intergenic
No off target data available for this crispr