ID: 939475822

View in Genome Browser
Species Human (GRCh38)
Location 2:142685552-142685574
Sequence ATGTTTCAGAATCATCCTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939475822_939475824 9 Left 939475822 2:142685552-142685574 CCTCAAGGATGATTCTGAAACAT No data
Right 939475824 2:142685584-142685606 CTTAATTATCTTTAGAGTAAGGG No data
939475822_939475823 8 Left 939475822 2:142685552-142685574 CCTCAAGGATGATTCTGAAACAT No data
Right 939475823 2:142685583-142685605 TCTTAATTATCTTTAGAGTAAGG No data
939475822_939475825 24 Left 939475822 2:142685552-142685574 CCTCAAGGATGATTCTGAAACAT No data
Right 939475825 2:142685599-142685621 AGTAAGGGACACGAGAAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939475822 Original CRISPR ATGTTTCAGAATCATCCTTG AGG (reversed) Intergenic
No off target data available for this crispr