ID: 939480937

View in Genome Browser
Species Human (GRCh38)
Location 2:142746353-142746375
Sequence GTGAATTAAACAATAATAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939480937_939480940 8 Left 939480937 2:142746353-142746375 CCATCTATTATTGTTTAATTCAC No data
Right 939480940 2:142746384-142746406 CAACCACTCTCCAATATTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939480937 Original CRISPR GTGAATTAAACAATAATAGA TGG (reversed) Intergenic
No off target data available for this crispr