ID: 939482770

View in Genome Browser
Species Human (GRCh38)
Location 2:142770371-142770393
Sequence CAAAATGCTGATAGTGACAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939482767_939482770 4 Left 939482767 2:142770344-142770366 CCTAGAGACTGGTTAAGGTGTTG No data
Right 939482770 2:142770371-142770393 CAAAATGCTGATAGTGACATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939482770 Original CRISPR CAAAATGCTGATAGTGACAT GGG Intergenic
No off target data available for this crispr