ID: 939488221

View in Genome Browser
Species Human (GRCh38)
Location 2:142843908-142843930
Sequence ATTCTATTCATAGTCATCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939488221_939488225 13 Left 939488221 2:142843908-142843930 CCTTTGATGACTATGAATAGAAT No data
Right 939488225 2:142843944-142843966 CCTGTTCCCTTGTAATTTTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939488221 Original CRISPR ATTCTATTCATAGTCATCAA AGG (reversed) Intergenic
No off target data available for this crispr