ID: 939493776

View in Genome Browser
Species Human (GRCh38)
Location 2:142904996-142905018
Sequence ATGCATCTTGATGGGCAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939493776_939493781 19 Left 939493776 2:142904996-142905018 CCTGGCTGCCCATCAAGATGCAT No data
Right 939493781 2:142905038-142905060 TATGCAAATTCGTTTCAGAGAGG No data
939493776_939493782 20 Left 939493776 2:142904996-142905018 CCTGGCTGCCCATCAAGATGCAT No data
Right 939493782 2:142905039-142905061 ATGCAAATTCGTTTCAGAGAGGG No data
939493776_939493783 26 Left 939493776 2:142904996-142905018 CCTGGCTGCCCATCAAGATGCAT No data
Right 939493783 2:142905045-142905067 ATTCGTTTCAGAGAGGGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939493776 Original CRISPR ATGCATCTTGATGGGCAGCC AGG (reversed) Intronic
No off target data available for this crispr