ID: 939494109

View in Genome Browser
Species Human (GRCh38)
Location 2:142907501-142907523
Sequence TGGCAAATAGCAGTTGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939494103_939494109 13 Left 939494103 2:142907465-142907487 CCAGAGGGGTGGGAGTCAATGGC No data
Right 939494109 2:142907501-142907523 TGGCAAATAGCAGTTGTGGATGG No data
939494101_939494109 19 Left 939494101 2:142907459-142907481 CCAGATCCAGAGGGGTGGGAGTC No data
Right 939494109 2:142907501-142907523 TGGCAAATAGCAGTTGTGGATGG No data
939494099_939494109 23 Left 939494099 2:142907455-142907477 CCTGCCAGATCCAGAGGGGTGGG No data
Right 939494109 2:142907501-142907523 TGGCAAATAGCAGTTGTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939494109 Original CRISPR TGGCAAATAGCAGTTGTGGA TGG Intronic
No off target data available for this crispr