ID: 939494109 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:142907501-142907523 |
| Sequence | TGGCAAATAGCAGTTGTGGA TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 939494103_939494109 | 13 | Left | 939494103 | 2:142907465-142907487 | CCAGAGGGGTGGGAGTCAATGGC | No data | ||
| Right | 939494109 | 2:142907501-142907523 | TGGCAAATAGCAGTTGTGGATGG | No data | ||||
| 939494101_939494109 | 19 | Left | 939494101 | 2:142907459-142907481 | CCAGATCCAGAGGGGTGGGAGTC | No data | ||
| Right | 939494109 | 2:142907501-142907523 | TGGCAAATAGCAGTTGTGGATGG | No data | ||||
| 939494099_939494109 | 23 | Left | 939494099 | 2:142907455-142907477 | CCTGCCAGATCCAGAGGGGTGGG | No data | ||
| Right | 939494109 | 2:142907501-142907523 | TGGCAAATAGCAGTTGTGGATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 939494109 | Original CRISPR | TGGCAAATAGCAGTTGTGGA TGG | Intronic | ||
| No off target data available for this crispr | |||||