ID: 939495704

View in Genome Browser
Species Human (GRCh38)
Location 2:142925608-142925630
Sequence GGTCATGAGACCACATTTAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939495704_939495705 -10 Left 939495704 2:142925608-142925630 CCAATAAATGTGGTCTCATGACC No data
Right 939495705 2:142925621-142925643 TCTCATGACCAGTACTGACCTGG No data
939495704_939495706 -4 Left 939495704 2:142925608-142925630 CCAATAAATGTGGTCTCATGACC No data
Right 939495706 2:142925627-142925649 GACCAGTACTGACCTGGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939495704 Original CRISPR GGTCATGAGACCACATTTAT TGG (reversed) Intronic
No off target data available for this crispr