ID: 939501068

View in Genome Browser
Species Human (GRCh38)
Location 2:142985163-142985185
Sequence TACCTTGTAGGAACACCAGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 78
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 71}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939501068 Original CRISPR TACCTTGTAGGAACACCAGC AGG (reversed) Exonic
913037697 1:114988168-114988190 TACATTGTAGGAATTCCAGAAGG + Intronic
915231450 1:154448696-154448718 TTCCATGTAGGAACAGCTGCAGG + Intronic
919405942 1:197184034-197184056 TACCTTGTAGAAACATCAGAGGG - Intronic
1064031071 10:11883257-11883279 TACCCTGTAGCTACACTAGCAGG + Intergenic
1076388223 10:130074821-130074843 TCCCTTGTAGGGACACCAGGAGG - Intergenic
1080582981 11:33658576-33658598 GGACTTCTAGGAACACCAGCAGG - Intronic
1092284403 12:7120551-7120573 GACCTTGTAGGTACAGCAGGAGG - Intergenic
1093687107 12:22069705-22069727 TAACTTGTAGGAACGACGGCTGG - Intronic
1097818092 12:64097812-64097834 TACAGTGCAGGAACACCAGGTGG + Intronic
1098502791 12:71213186-71213208 TACATTGGGGGAACATCAGCAGG - Intronic
1099079695 12:78161207-78161229 TACCTTGTAGGATCACCATGAGG + Intronic
1101804557 12:108052093-108052115 TACCTTTTAGGAACATTAGGAGG - Intergenic
1112039759 13:95535260-95535282 TATCTTTTAGGAAAATCAGCTGG + Intronic
1120949057 14:90024123-90024145 TACCTTACAGGATCTCCAGCAGG - Intronic
1122860661 14:104581001-104581023 TACCAGGTAGGAACAGGAGCAGG - Intronic
1124206773 15:27727535-27727557 TACCTTGTAGGACCTGCATCTGG - Intergenic
1129660663 15:77551137-77551159 TACCATGTGGGAGAACCAGCTGG + Intergenic
1129882987 15:79019216-79019238 TGCCCTGTGGGGACACCAGCAGG - Intronic
1130709973 15:86270392-86270414 TACCTTGCAGGAAAAAAAGCAGG - Intronic
1131610622 15:93957545-93957567 TAACTTGAAGGGACTCCAGCTGG + Intergenic
1131644506 15:94327530-94327552 TACCTTCTCTGAACACCAGATGG + Intronic
1133108424 16:3530548-3530570 TACCTAGCAGGAACACAAGCAGG - Exonic
1133834976 16:9359759-9359781 TACCTTGTAGGACATCAAGCAGG - Intergenic
1135679681 16:24445777-24445799 TACATTGTAGGACACCCAGCGGG + Intergenic
1136142684 16:28297640-28297662 TATCTTGTAGGATCATCAGGGGG + Intronic
1136547359 16:30963169-30963191 TACCATGTTGGATCACCAGAAGG - Intronic
1154021315 18:10666235-10666257 TACCTTAAAGAAACTCCAGCGGG + Intergenic
1156964815 18:43078380-43078402 TACCTGGAAGGAAGACTAGCTGG - Intronic
1162117772 19:8441984-8442006 TAGCCTGTAGGAAGAGCAGCAGG + Intronic
1167972991 19:53200436-53200458 AAACTTGTAGGAAGACCAACAGG - Intergenic
926490685 2:13522661-13522683 TTCCTTTTAGAAACACCAGCTGG - Intergenic
927497851 2:23562689-23562711 TAACTTGTAGGAAGACAAGCAGG + Intronic
929202735 2:39254506-39254528 TGTCTTGTAGGCACACTAGCAGG + Exonic
934859830 2:97755391-97755413 TGCCATGTAGAAATACCAGCTGG - Intergenic
936349177 2:111699987-111700009 CACCTTTTAGGAACTCGAGCTGG + Intergenic
939501068 2:142985163-142985185 TACCTTGTAGGAACACCAGCAGG - Exonic
942270987 2:174274834-174274856 AATCTTGTAAGAACTCCAGCTGG - Intergenic
943290880 2:186069833-186069855 GACTTTGAAGGAACACAAGCAGG + Intergenic
1171071352 20:22071279-22071301 TATCTGGTAGCAATACCAGCGGG - Intergenic
1172105690 20:32516061-32516083 TTCCTCGTGGGAACACCAGGTGG + Intronic
1178643719 21:34367103-34367125 TCTCTTGTAGGAAGCCCAGCCGG - Intronic
1179097073 21:38325441-38325463 TCCCTGGTTGAAACACCAGCTGG + Intergenic
1180976084 22:19849228-19849250 TACCTTGTAGGTAAAACAACTGG - Exonic
1181376525 22:22462981-22463003 TACATTATAGGAACACCAAAAGG - Intergenic
1183762081 22:39830549-39830571 TTCCTTATAGGAATTCCAGCAGG + Intronic
949804863 3:7943579-7943601 TACCTTATGGGAACACAAGTGGG - Intergenic
954163879 3:48740665-48740687 TACCCACTAGGAAAACCAGCAGG - Intergenic
955594365 3:60572945-60572967 TACCTTGTAGGGACATCAAGAGG - Intronic
957592806 3:82223124-82223146 TAACATGTAGCAACACCAACAGG - Intergenic
960122591 3:113962339-113962361 TTCATTGTAGGATCAGCAGCAGG + Exonic
961365329 3:126395824-126395846 CACCTTGTGGGGACACCTGCCGG - Intronic
961426306 3:126851239-126851261 AACCTTGCAGAACCACCAGCAGG - Intronic
964751028 3:160054048-160054070 TTCAATGTTGGAACACCAGCAGG - Intergenic
980510226 4:133775794-133775816 TACATTGTAGGAACATCATAGGG + Intergenic
983185792 4:164699176-164699198 CACCTTGGAGGCACACCAGAAGG - Intergenic
990117633 5:52408969-52408991 TACTTTATAGGAACACTGGCAGG - Intergenic
994320408 5:98387830-98387852 CCCCTTGCAGGAACACCAGATGG - Intergenic
1002421211 5:179150047-179150069 TACCTTGCAGGAAAAGCAGGGGG + Intronic
1003077281 6:2993692-2993714 TACTTAGTAGGAAAACCAGTAGG + Intronic
1004144230 6:13049848-13049870 TTCCTTGTAGGAACTGCAGGTGG - Intronic
1010434526 6:75814003-75814025 GACCTAGTGAGAACACCAGCTGG - Intronic
1010673249 6:78711745-78711767 TACCTTGTAGCAGCACCAATAGG + Intergenic
1013680653 6:112521868-112521890 TACCTTCCAGGAACACCTGTAGG + Intergenic
1018103922 6:160465467-160465489 TACATTGTAGGACACCCAGCTGG + Intergenic
1018112215 6:160546695-160546717 TACATTGTAGGACACCCAGCTGG + Intronic
1018130997 6:160732476-160732498 TACATTGTAGGACACCCAGCTGG - Intronic
1030489998 7:110220478-110220500 TATTATGTAGGAACACCATCTGG - Intergenic
1033823549 7:145162406-145162428 AACATTGTAGGCAGACCAGCAGG + Intergenic
1033973475 7:147071362-147071384 TACTCTGTGGGAACAGCAGCAGG + Intronic
1037720636 8:21440656-21440678 TACCTTGTTGGAACTCCACTGGG - Intergenic
1040829772 8:51663711-51663733 TACCTTTTAGTGACACCTGCTGG - Intronic
1049408764 8:142463259-142463281 TTCCTGGCAGGAGCACCAGCTGG + Intronic
1058300162 9:103361609-103361631 AACCTAGTAGGAACACTAGATGG - Intergenic
1062464510 9:136675233-136675255 TGACTTCCAGGAACACCAGCAGG - Intronic
1187194243 X:17067021-17067043 TAACTTTTTGGAACACCAGATGG + Intronic
1188230851 X:27660913-27660935 TACAGTATAGGAAAACCAGCTGG - Intronic
1188725166 X:33573979-33574001 TACATTGTAGGCACACTTGCAGG - Intergenic
1197875204 X:131095553-131095575 TCCCTTCTAGGAACCCCATCAGG - Intergenic