ID: 939501116

View in Genome Browser
Species Human (GRCh38)
Location 2:142986100-142986122
Sequence TCCTATTGGATAGCATCTTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 114}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939501116 Original CRISPR TCCTATTGGATAGCATCTTA AGG (reversed) Intronic
902101504 1:13994058-13994080 TCTTCTTGGAGAACATCTTAAGG + Intergenic
910083925 1:83375100-83375122 TCATATTTCATAGCATATTATGG + Intergenic
910475155 1:87598150-87598172 ACCTATTGGGCAGCATCATAAGG + Intergenic
911729571 1:101278882-101278904 TGCCATTGGAAAGCATCTTTGGG + Intergenic
912603569 1:110964190-110964212 TGCCATTGGATTGCATCATAAGG - Intergenic
918415604 1:184303745-184303767 TACTATTTGATAGCATGATAGGG - Intergenic
924013946 1:239699311-239699333 TCCTATTGGACCTCATCTAAGGG - Intronic
1063868387 10:10391748-10391770 TCATATGGCATAGCCTCTTAGGG + Intergenic
1065817404 10:29494707-29494729 TCCAATTGGATGGCATCCCAAGG + Intronic
1065955457 10:30689753-30689775 TCCAATTGGATGGCATCCCAAGG - Intergenic
1066075577 10:31872404-31872426 TCCTATAGGGTAGTATGTTATGG - Intronic
1069224908 10:65930814-65930836 GCATATTTGACAGCATCTTAAGG - Intronic
1073028808 10:100508427-100508449 TTCAATTTGATAGCATCTTGTGG - Intronic
1077841049 11:5975179-5975201 TCCTATCAGACAGCCTCTTAAGG + Intergenic
1077988557 11:7380356-7380378 TACTATTCGATAGCACCATAGGG + Intronic
1078417993 11:11181480-11181502 TGGTATTTGATAGCCTCTTAAGG - Intergenic
1079073855 11:17371166-17371188 TTCTACTGGACAGCATATTATGG + Intronic
1080213195 11:29810880-29810902 TACTATTTGATAGCATAGTAGGG - Intergenic
1081657065 11:44864457-44864479 TCCTATTGGATAGGATGCTCAGG + Intronic
1086233742 11:84600724-84600746 TCTTATAGGATAGCATTTTTGGG + Intronic
1088035233 11:105303861-105303883 TCCAATTTGATAGAATCTTCTGG + Intergenic
1088341236 11:108770353-108770375 TACTATTTGATAGCATAATAGGG - Intronic
1090161730 11:124502254-124502276 TCCTTTTAAATATCATCTTATGG - Intergenic
1090669460 11:128936239-128936261 TCCTATTGTCCAGCATCCTATGG + Intronic
1093004184 12:14034284-14034306 TCTTGTAGGATAGTATCTTAGGG - Intergenic
1093857446 12:24123172-24123194 TCCTATTCACTAGCATCTGAGGG + Intergenic
1095783580 12:46086687-46086709 ACCTATTGGAAAGGATCTTCTGG + Intergenic
1096513570 12:52144805-52144827 TCCTCTTGGACTGCATCGTAGGG + Intergenic
1098142461 12:67464331-67464353 TCCTATTTGATAGCATAACAGGG - Intergenic
1101724653 12:107378854-107378876 TCCTATTTTACAGCCTCTTAGGG - Intronic
1103566802 12:121820176-121820198 TCCTTTTGGGGAGCATCTCATGG - Intronic
1106848820 13:33766334-33766356 TCCTTTTTGATAGCAGCCTACGG + Intergenic
1107059149 13:36136792-36136814 TTCTATTTGAAAGCATTTTAGGG - Intergenic
1107726547 13:43305195-43305217 TCCTGCTGGAGAGCCTCTTATGG + Intronic
1110597123 13:77331431-77331453 TACTATTTGATAGCATAATAGGG - Intergenic
1112775716 13:102842413-102842435 GCCCTTTAGATAGCATCTTAAGG + Intronic
1116438339 14:44920597-44920619 TCCTATTGCATTGCATCATAAGG - Intergenic
1119329172 14:73781288-73781310 TAGAATTGGATAGGATCTTACGG - Intronic
1124008477 15:25813821-25813843 TCATATTGGATAGCTTCTATTGG - Intronic
1126820084 15:52494254-52494276 TCATATTGGATAGCAGATTATGG - Intronic
1130819778 15:87482477-87482499 TACTATTTGATAGCATAATAAGG + Intergenic
1135417056 16:22276548-22276570 GCCTATTGGATAGTAACTTCTGG - Intronic
1136297098 16:29309812-29309834 TCACATTGGATGGCATCTGAGGG + Intergenic
1137851544 16:51750907-51750929 TCCTCTTGGATAACATCCGAAGG + Intergenic
1138045306 16:53717040-53717062 TCCAATTGTATAGTATTTTATGG + Intronic
1140265883 16:73420329-73420351 TCATATTAGATAGTATCTAATGG + Intergenic
1142058648 16:88015916-88015938 TCACATTGGATGGCATCTGATGG + Intronic
1143637339 17:8173114-8173136 TCCTATTGAATACCATCCTGAGG + Intergenic
1146315167 17:31801239-31801261 TCATCTTGAATAGCATCTTGGGG - Intergenic
1149244200 17:54686029-54686051 TCCTATCTGATAGGAACTTAGGG - Intergenic
1149278846 17:55078849-55078871 TCCCATTGGATGCCATCATATGG + Intronic
1151088694 17:71410417-71410439 TCTTTTTGGGGAGCATCTTATGG - Intergenic
1151897990 17:76993269-76993291 TTCTCTGGTATAGCATCTTAGGG + Intergenic
1152011326 17:77720338-77720360 ACCTATTCGAGAGCATCTTGAGG - Intergenic
1153095937 18:1403255-1403277 TCGTATTGGATAGCATACTAAGG - Intergenic
1157100777 18:44727348-44727370 TCTCATTTGAAAGCATCTTAAGG + Intronic
1167964692 19:53133517-53133539 TCCTACAGGATACCATTTTATGG - Intronic
928861324 2:35860880-35860902 TCTTATTGCATAGTGTCTTAGGG + Intergenic
929420756 2:41787370-41787392 TCCTATTGGATGGCTTCCTATGG - Intergenic
931413638 2:62059566-62059588 TCCTTTTGAAAAGCTTCTTATGG - Intronic
933356670 2:81218928-81218950 TACTATTTGATAGCATAATAGGG - Intergenic
936793605 2:116181694-116181716 TACTATTTGAGAGCACCTTATGG - Intergenic
939501116 2:142986100-142986122 TCCTATTGGATAGCATCTTAAGG - Intronic
939780283 2:146437920-146437942 TCCTAATGAATAGATTCTTATGG - Intergenic
941438893 2:165508722-165508744 TCTCATTGGACAGCACCTTATGG + Intronic
941672561 2:168310537-168310559 GGCTCTTGGATAGCATTTTAGGG - Intergenic
944345080 2:198654024-198654046 TCTCATTAGATAGCATTTTAGGG + Intergenic
944452571 2:199857801-199857823 CCCTATTTGATTGCATCTTTTGG - Intergenic
945122975 2:206477225-206477247 TTCTAGTGGATGGCATCTAATGG - Intronic
945674176 2:212834938-212834960 TACTATTTGATAGCATATCAGGG - Intergenic
946735763 2:222753071-222753093 TCTTTTTGGATTGTATCTTAAGG + Intergenic
947037690 2:225877992-225878014 TTCTATTGGAATGCATCTTAAGG - Intergenic
947245312 2:228041095-228041117 TCATATAGGAAAACATCTTATGG - Intronic
1168782622 20:506601-506623 TCCTACTGGATAGAATCCTCTGG + Intronic
1171349401 20:24491162-24491184 GCCAACTGGTTAGCATCTTAAGG - Intronic
1174728625 20:52891556-52891578 TACTATTTGATAGCATAATAGGG + Intergenic
952171981 3:30816895-30816917 CTGTATTGTATAGCATCTTAGGG + Intronic
958729948 3:97950852-97950874 TCCTTTTGGATACCATCTCGGGG - Exonic
958887885 3:99748710-99748732 CTCTATTTGACAGCATCTTAGGG - Intronic
959090189 3:101893992-101894014 TCCTAATGGGCAGCATCTTGGGG + Intergenic
959765420 3:110021383-110021405 TACTATTTGATAGCATAATAAGG - Intergenic
962249749 3:133828714-133828736 TCCTATTGGCTAGCTTCCTAAGG - Exonic
963288925 3:143466683-143466705 TCCTACTGGATTGTATCTTGAGG + Intronic
964049861 3:152377499-152377521 GCCTATTGAATAGAATTTTAGGG + Intronic
967092074 3:186143390-186143412 TCCCATTAGATAGCATCTCTTGG + Intronic
972005553 4:34099353-34099375 TACTATTTGATAGCATAATAGGG - Intergenic
973167010 4:47090789-47090811 TCAAATTGCATAGCATTTTAAGG - Intronic
973236244 4:47909191-47909213 ACATATTGCTTAGCATCTTAGGG - Intronic
978661410 4:111131411-111131433 TACTATTTGATAGCATGATAAGG - Intergenic
980067342 4:128204300-128204322 TACTATTTGATAGCATAATAGGG + Intronic
982763828 4:159320539-159320561 TCCTATTGGACAGAATCTTTGGG + Intronic
983437946 4:167739983-167740005 TCTGATTAGATAGCATCTTTTGG + Intergenic
984064331 4:175029184-175029206 TCATATTTGATAGCATCCTCAGG - Intergenic
985099011 4:186439271-186439293 TACTATTTGATAGCATAATAGGG + Intronic
989667061 5:43866896-43866918 TCCTGCTAGATAGCATCTTGAGG + Intergenic
992020656 5:72620341-72620363 CCATATTGGATGACATCTTAGGG + Intergenic
993786137 5:92139745-92139767 TCCCATAGGATAGGATCGTAAGG + Intergenic
993865412 5:93188745-93188767 TACTATTTGATAGCATAATAGGG + Intergenic
1007013301 6:38438271-38438293 TACTACTGGATTGCAGCTTATGG + Intronic
1007355310 6:41310717-41310739 TTCTATTGGATATAATTTTAAGG + Intergenic
1008229972 6:48974557-48974579 TCTTATTGCAAAGCATCTGAGGG + Intergenic
1013203053 6:107919859-107919881 TGCTATTTGATAGTATTTTATGG - Intronic
1014883366 6:126749423-126749445 TCCTCTTTGATAGTTTCTTAGGG - Intergenic
1016642954 6:146371534-146371556 TACTATTTGATAGCACCGTAGGG - Intronic
1016873372 6:148840469-148840491 TCCTAGTGGTTAGCATCAGAAGG + Intronic
1017585585 6:155919089-155919111 ACCTCTTGGATAGAATCTTGAGG - Intergenic
1021701042 7:23319862-23319884 TTCTGTGGGAAAGCATCTTAGGG - Intronic
1027300755 7:76831237-76831259 TCATATTTCATAGCATATTATGG + Intergenic
1029565769 7:101336620-101336642 TCCTATTGGATTGCATTAAAAGG + Intergenic
1031653916 7:124327842-124327864 TTCTATAGGATAGCATCTTGGGG - Intergenic
1033191283 7:139283003-139283025 TCCTAATGTAAAGCATCATATGG - Exonic
1036200754 8:6769737-6769759 TACTATTTGATAGCATAATAGGG - Intergenic
1043050472 8:75379031-75379053 TCTTATTGGATCGCATCATGGGG + Intergenic
1045807239 8:106177909-106177931 TACTATTTGATAGCATTATAGGG - Intergenic
1046135202 8:110017280-110017302 TCCTATTTGATAGCACAATAGGG - Intergenic
1047297224 8:123581675-123581697 TCCTATTGGGTATGATCTGAGGG + Intergenic
1051260626 9:15260971-15260993 TCATATTCCAGAGCATCTTACGG - Intronic
1191056949 X:56251972-56251994 TACTATTTGATAGCATGATAGGG - Intronic
1194570810 X:95552463-95552485 TTCTAGAGGATAGAATCTTAAGG - Intergenic
1196361513 X:114866561-114866583 TACTATTGGATAGCACAATAGGG - Intronic
1198838961 X:140835678-140835700 TCCTCTTGGAAAGAGTCTTAAGG - Intergenic
1199358733 X:146892149-146892171 TACTATTCGATAGCATAATAGGG + Intergenic
1200302968 X:154996972-154996994 TCCTACTGGAAAGCTTCTGAGGG - Exonic