ID: 939507972

View in Genome Browser
Species Human (GRCh38)
Location 2:143072473-143072495
Sequence CCTGGTATACCTAAGAATGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939507972_939507979 -1 Left 939507972 2:143072473-143072495 CCTGCATTCTTAGGTATACCAGG No data
Right 939507979 2:143072495-143072517 GGAAATGTTGAATAGGAGGGTGG No data
939507972_939507977 -5 Left 939507972 2:143072473-143072495 CCTGCATTCTTAGGTATACCAGG No data
Right 939507977 2:143072491-143072513 CCAGGGAAATGTTGAATAGGAGG No data
939507972_939507975 -8 Left 939507972 2:143072473-143072495 CCTGCATTCTTAGGTATACCAGG No data
Right 939507975 2:143072488-143072510 ATACCAGGGAAATGTTGAATAGG No data
939507972_939507978 -4 Left 939507972 2:143072473-143072495 CCTGCATTCTTAGGTATACCAGG No data
Right 939507978 2:143072492-143072514 CAGGGAAATGTTGAATAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939507972 Original CRISPR CCTGGTATACCTAAGAATGC AGG (reversed) Intergenic
No off target data available for this crispr