ID: 939507978

View in Genome Browser
Species Human (GRCh38)
Location 2:143072492-143072514
Sequence CAGGGAAATGTTGAATAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939507972_939507978 -4 Left 939507972 2:143072473-143072495 CCTGCATTCTTAGGTATACCAGG No data
Right 939507978 2:143072492-143072514 CAGGGAAATGTTGAATAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939507978 Original CRISPR CAGGGAAATGTTGAATAGGA GGG Intergenic
No off target data available for this crispr