ID: 939508791

View in Genome Browser
Species Human (GRCh38)
Location 2:143081368-143081390
Sequence AGGACTATTGTGAAGATTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 641
Summary {0: 2, 1: 3, 2: 29, 3: 115, 4: 492}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939508791_939508793 -4 Left 939508791 2:143081368-143081390 CCTTTAATCTTCACAATAGTCCT 0: 2
1: 3
2: 29
3: 115
4: 492
Right 939508793 2:143081387-143081409 TCCTATCAGGTGCCAGATGTCGG No data
939508791_939508797 27 Left 939508791 2:143081368-143081390 CCTTTAATCTTCACAATAGTCCT 0: 2
1: 3
2: 29
3: 115
4: 492
Right 939508797 2:143081418-143081440 TAGCTACCCCAGTTAGGTGCAGG No data
939508791_939508796 21 Left 939508791 2:143081368-143081390 CCTTTAATCTTCACAATAGTCCT 0: 2
1: 3
2: 29
3: 115
4: 492
Right 939508796 2:143081412-143081434 CTTTTTTAGCTACCCCAGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939508791 Original CRISPR AGGACTATTGTGAAGATTAA AGG (reversed) Intergenic
901442149 1:9284547-9284569 AGGGCTCATGTGAGGATTAAAGG + Intergenic
902701674 1:18176494-18176516 AGAACTGTTGTCGAGATTAAAGG + Intronic
902745667 1:18472303-18472325 AGGGCTGCTGTGAAGATTAAAGG + Intergenic
902885937 1:19404853-19404875 AGGACAATTGTGAATATTAAAGG - Intronic
902928079 1:19710511-19710533 AGGATTGTTGTGAAGAGTAAAGG - Intronic
902990374 1:20183543-20183565 AGGAGCGTTGTGAAGATGAAGGG + Intergenic
904899599 1:33846550-33846572 AGGATAATGATGAAGATTAAAGG + Intronic
905011967 1:34753779-34753801 AGGACCTTTGTGAAAAATAATGG - Intronic
905024066 1:34837862-34837884 AGGATTGTTGTGTGGATTAAGGG - Intronic
905307001 1:37026576-37026598 AGCGTTATTGTGAGGATTAAAGG - Intronic
905451635 1:38060675-38060697 TGGGCTCTTGTGAGGATTAAAGG - Intergenic
905458813 1:38107336-38107358 AGGACTGTGGTGAAGGTCAAAGG + Intergenic
905475433 1:38223833-38223855 AGGATCATTGTTAGGATTAAAGG - Intergenic
905536560 1:38726820-38726842 AAGACTGTTGTGAAGATTAAGGG + Intergenic
905607108 1:39311492-39311514 AGGGTTATTTTGAAAATTAATGG + Intronic
905683399 1:39890996-39891018 AGGACTGTTGTGAAGATTAAAGG - Intergenic
905943132 1:41879952-41879974 AGGACTGTGGTGAGGTTTAATGG - Intronic
906068108 1:42996980-42997002 AAGGCTATTGTGAAGGTTAAAGG - Intergenic
907277504 1:53325352-53325374 AGGACTGTTATGAAGATTAAAGG + Intronic
907673690 1:56499206-56499228 AGGAATCATATGAAGATTAAAGG + Intronic
907714034 1:56911324-56911346 AGGATTATTGTGAGGATTAAGGG - Intronic
907714127 1:56912012-56912034 AGGATCACTGTGAGGATTAAGGG + Intronic
907816116 1:57919687-57919709 AGGATTGTTGTGAAGTTTACAGG + Intronic
907819138 1:57949901-57949923 AGGACTTTTCTGAGGATTTAAGG - Intronic
907964321 1:59314487-59314509 GGGATTGTTGTGAAGATTAAAGG - Intronic
908657851 1:66406603-66406625 AGGCTCTTTGTGAAGATTAAAGG - Intergenic
908925455 1:69249255-69249277 GGGATTATCGTGAAGATCAAAGG + Intergenic
909063083 1:70901585-70901607 ATGATTATTGTGAAGAGCAAAGG + Intronic
909313078 1:74177971-74177993 AATACTATTGTGCACATTAATGG + Intronic
909494386 1:76262179-76262201 AGGATTACTGTGATGATTAAGGG - Intronic
909943547 1:81637288-81637310 AAGGCTTTTGTGAAGATTAAAGG - Intronic
910720574 1:90281663-90281685 AGGATTGTTCTGAAGATTAGAGG - Intergenic
911101928 1:94102123-94102145 AGGATTGTTGTGAGGAGTAAGGG + Intronic
911472034 1:98330999-98331021 ACAACTGTTGTGAATATTAATGG + Intergenic
911512960 1:98829378-98829400 AGGAATAATGATAAGATTAAGGG + Intergenic
911637756 1:100254419-100254441 AGGGATATTTTGAAGATCAAAGG + Intergenic
912202833 1:107477650-107477672 ATTACTTTTGGGAAGATTAAGGG - Intronic
912934220 1:113988740-113988762 GGGATTATTGTGCAGATCAAAGG - Intergenic
913250174 1:116906774-116906796 AGGACTCTTGTGAGGTTTTAGGG + Intergenic
913360166 1:117971733-117971755 ATGAATAATGTGAAGATTCAAGG + Intronic
913456063 1:119032040-119032062 AGCACTATTCTTAAGAATAAGGG + Exonic
914424385 1:147561454-147561476 AATGCCATTGTGAAGATTAAAGG + Intronic
914954356 1:152147629-152147651 AGGATTATTTTGAAGTTTTAGGG - Intergenic
915253698 1:154609051-154609073 AGGGCTGTTGTGAAGATTAAGGG - Intronic
916275028 1:162984705-162984727 AAAAATAATGTGAAGATTAATGG + Intergenic
916339883 1:163720889-163720911 AGGGTTATTATGAAGCTTAAAGG - Intergenic
916757184 1:167783581-167783603 AGGACTGTTGTGAGGACTAAAGG - Intronic
917074212 1:171186929-171186951 AGTGCTATTTTGAAGATTAAGGG + Intronic
917708453 1:177658807-177658829 AGGGCTCTTGTGAGGAATAAGGG - Intergenic
917739576 1:177949616-177949638 AGAGTTATTGTGAAAATTAAGGG - Intronic
917747073 1:178020654-178020676 AGGGTTGTTGTGAAGGTTAAAGG + Intergenic
917799980 1:178561444-178561466 AGGATTCTTGTGAAAATTCAAGG - Intergenic
918027438 1:180765142-180765164 AGCACTGTTGCGAGGATTAAAGG - Intronic
918615114 1:186535205-186535227 ACGGTTATTGTGAAGATAAAAGG + Intergenic
919172205 1:193969114-193969136 AGACCTATTGTGAAGGTTTATGG + Intergenic
919353189 1:196486405-196486427 AGCATTATTGTGAAAACTAAAGG + Intronic
919412446 1:197262680-197262702 AGGACTATTGTTAAGAAGAAGGG - Intergenic
920030059 1:203031790-203031812 AGGACATTTGTGTTGATTAATGG + Intronic
920030168 1:203032751-203032773 AGGACTAATGTCAAAACTAATGG - Intronic
920549247 1:206844782-206844804 AGAACTATCGTGAGGAGTAAAGG - Intergenic
920740951 1:208580855-208580877 AGGGATGTTTTGAAGATTAAAGG + Intergenic
920759336 1:208767172-208767194 AGGACCATTGAGAAAAATAAAGG + Intergenic
921166511 1:212511825-212511847 AGGACTGCTGTGAGGATCAAAGG + Intergenic
921960082 1:221025328-221025350 AGTACTGTTGTGAGGATTAAAGG - Intergenic
922441661 1:225660510-225660532 AGGAATATTGTGAAGATTAATGG - Intergenic
923118705 1:230969791-230969813 AGGGCTACTGTGAAGAATAAAGG + Intronic
923405164 1:233652495-233652517 AGAGCTGCTGTGAAGATTAAAGG + Intronic
923411524 1:233714784-233714806 ACGACCATTTTGAAGACTAAAGG + Intergenic
923432118 1:233932801-233932823 AAGACTAATGTCAAGACTAATGG - Intronic
923693048 1:236215340-236215362 AGTGCTATTGTGAAGATTAACGG + Intronic
924016866 1:239736151-239736173 GGGACTTTTGTGAAGATTAAAGG - Intronic
924121505 1:240804187-240804209 AGCATTGTTGTGATGATTAAAGG + Intronic
924400868 1:243679929-243679951 AGGACTAACGTGAAGTTCAAAGG + Intronic
924426996 1:243960552-243960574 AGGAGTTTTGTGAAAAATAAAGG + Intergenic
924593271 1:245423272-245423294 AGGGTTACTGTGAAGATGAAGGG - Intronic
924595023 1:245437444-245437466 AGGAGAAGTGTAAAGATTAATGG - Intronic
924755318 1:246935562-246935584 AGAACTGTTGTAAAGATGAAAGG + Intergenic
1065934549 10:30509586-30509608 AGGACTATCAGGAAGTTTAAAGG + Intergenic
1067385889 10:45817500-45817522 AGGTCCATTGTGAGGATAAATGG - Exonic
1067981526 10:51091796-51091818 AGAACTTTTATGAAGATTAGAGG - Intronic
1068929754 10:62577222-62577244 TGGACTATTGTGAAGGTTATGGG + Intronic
1070279627 10:75038956-75038978 AGGCCTATTGAGAAGAATCAAGG + Intronic
1070330979 10:75416979-75417001 AGGATTGTTGCGAGGATTAAGGG - Intergenic
1070465526 10:76719349-76719371 AGGACTATAGTGACGATTATAGG - Intergenic
1071396213 10:85226573-85226595 AGGATCATTGTGATGATTACAGG - Intergenic
1071494480 10:86158328-86158350 AGGGCTATTGTGAGAATTAAAGG + Intronic
1071554037 10:86588744-86588766 AGGAGTATGGTGAGGATGAAAGG - Intergenic
1071907537 10:90190521-90190543 AGGACCATTGTGAAGAAGAAAGG - Intergenic
1072303368 10:94083984-94084006 AGTATTATTGGGAGGATTAAAGG + Intronic
1072558827 10:96549537-96549559 AGGGTTGATGTGAAGATTAAGGG + Intronic
1072705898 10:97680638-97680660 AGGATTAATTTGAAGATTGAAGG + Intronic
1073663763 10:105507290-105507312 AGAATTATTGCAAAGATTAAAGG + Intergenic
1074226004 10:111484861-111484883 AGAACTATTGTTAGGATGAAAGG + Intergenic
1074460492 10:113632435-113632457 AGGCCTAATGTGAAGATTTGTGG - Intronic
1074665976 10:115724782-115724804 AGGACAATTGTTAAGAATTAGGG + Intronic
1074716321 10:116222597-116222619 GGGGCTGTTGTGAAGATTACAGG + Intronic
1074760920 10:116666915-116666937 AAGATTGTTGTGAGGATTAAAGG - Intronic
1074951398 10:118340766-118340788 AGGGTTGTTGTGAAGATTAGTGG - Intronic
1075189723 10:120295858-120295880 AGAGCTGTTGTGAGGATTAAAGG - Intergenic
1075591175 10:123692701-123692723 AAGATTATGATGAAGATTAATGG - Exonic
1075600813 10:123767848-123767870 AAGACTGATGAGAAGATTAAAGG + Intronic
1079572797 11:21965461-21965483 AGGACCATTGTGCAAATTAAAGG + Intergenic
1079953210 11:26830179-26830201 AAGGTAATTGTGAAGATTAAAGG + Intergenic
1080313807 11:30925642-30925664 AGGGTTTCTGTGAAGATTAAAGG + Intronic
1080419149 11:32094708-32094730 AGGAATGTTGTGAGGAATAAAGG - Intronic
1082086156 11:48051657-48051679 AGGGCTGATGTGAAGAGTAAAGG - Intronic
1083269144 11:61562411-61562433 AGGACTATGGTGAGGTTTAAAGG + Intronic
1084848452 11:71919237-71919259 AGAATTGTTATGAAGATTAAAGG - Intronic
1085557716 11:77440471-77440493 AGGATTGCTGTGAAGATTAAAGG - Intronic
1085715066 11:78865201-78865223 AGGATTATTGTGAGAGTTAAAGG - Intronic
1085837275 11:79970599-79970621 AGGGATACTGGGAAGATTAAGGG + Intergenic
1086091843 11:83012636-83012658 AGGACCGTTGTGCAGATTAAAGG + Intronic
1086340512 11:85843778-85843800 AGGGCTGTTCTGAAGATTACTGG - Intergenic
1086538336 11:87877377-87877399 AGAATTATTGTGAGGAATAAAGG + Intergenic
1086943378 11:92820936-92820958 AGGGCTCTTGTGCAGATCAATGG + Intronic
1087003708 11:93447029-93447051 AGGATTGTTGTGAGGATTAGAGG + Intergenic
1087053293 11:93907390-93907412 GGGATTTTTGTGAGGATTAAAGG + Intergenic
1087269273 11:96094984-96095006 GGGATTGTTGTGCAGATTAAGGG - Intronic
1087594040 11:100231582-100231604 AGGACAATTTTGAGGATAAAGGG - Intronic
1089651235 11:119914754-119914776 AGGATTGTTATGAAGATTAAAGG - Intergenic
1089994528 11:122892963-122892985 AGGACTATTGAGAACATTCTAGG + Intronic
1090250364 11:125246684-125246706 AGGATTGTTGGGAATATTAAGGG + Intronic
1090503675 11:127286454-127286476 AGTACTATGGTAAAGAATAAAGG - Intergenic
1090715524 11:129427191-129427213 TGGATTATCGTGAGGATTAACGG - Intronic
1090954243 11:131500417-131500439 AGGACTGTTGTGAGACTTAAAGG - Intronic
1091875991 12:3933291-3933313 AGGACTACTCTGAAGGTCAAAGG + Intergenic
1092153033 12:6264139-6264161 AGGGCTGTTGTGAAGCTGAATGG + Intergenic
1092891934 12:12977246-12977268 AAGGCTACTGTAAAGATTAAAGG + Intronic
1092932395 12:13328519-13328541 AGAACTATTGTGGAGATTAAAGG - Intergenic
1093294124 12:17366813-17366835 AGGACTGTTTTGTAGATTAATGG - Intergenic
1093436150 12:19137643-19137665 AAGGCTATTGTGAGGATTATAGG - Intronic
1096178080 12:49536234-49536256 AGCGTTATTATGAAGATTAATGG + Intergenic
1096588070 12:52636750-52636772 AGTACTGTTGTGGAGATTAAAGG - Intergenic
1096961843 12:55587180-55587202 AGTACTATGGTGAAGAGGAATGG - Intergenic
1097411293 12:59256254-59256276 AGGATGATTGTAAATATTAAAGG - Intergenic
1097651534 12:62304168-62304190 AGGACTATTTCAAAGAGTAATGG - Intronic
1098089162 12:66882789-66882811 AGGGCTACTGTGAAGCTAAAAGG - Intergenic
1098196477 12:68007223-68007245 AGGATTATTTTGAGAATTAAAGG + Intergenic
1098690783 12:73485060-73485082 AGGTATATTCTGAAGATCAAGGG - Intergenic
1098792528 12:74842494-74842516 TGGGCTATTGTGCAGATTAAAGG - Intergenic
1099307706 12:80978745-80978767 GGGACTCTTATGAAGATAAATGG - Intronic
1100359821 12:93865991-93866013 AGCATTATTGAGAAGATTAATGG + Intronic
1100604605 12:96141325-96141347 AGGATTCTTGTGAAGATTATGGG - Intergenic
1100880465 12:99010308-99010330 AGGGTTGTTGTGAGGATTAAAGG + Intronic
1100987049 12:100212070-100212092 AGGAATAGTGTGGAAATTAATGG + Intronic
1101002631 12:100371936-100371958 AAGACTATTTTGAGAATTAAGGG + Intronic
1101284056 12:103291322-103291344 AGAAGTATTGGGAAAATTAAAGG + Intronic
1101539050 12:105647896-105647918 AGGGTAACTGTGAAGATTAAAGG + Intergenic
1101569693 12:105941916-105941938 AGGAAAATTGTGAAGGTTTATGG - Intergenic
1101749406 12:107571201-107571223 AGCATTGTTGTGAAGATTAAGGG - Intronic
1101803998 12:108047695-108047717 AGGAATATTGTAAAGAATAAAGG + Intergenic
1101956068 12:109213573-109213595 AGGACTATTCTGATGACAAAAGG + Intronic
1102581130 12:113888806-113888828 GGGACTATTGTGAGGACCAAAGG + Intronic
1102673696 12:114641743-114641765 AGTGCTGTTGTGAAGATGAAAGG - Intergenic
1103684535 12:122721558-122721580 AGGGTTTTTGTGAAGATTAAAGG - Intergenic
1103721585 12:122978306-122978328 AGGGCTATTGTGATGACTTAAGG - Intronic
1104324256 12:127781178-127781200 GGGGCTCTTGTGAGGATTAAAGG - Intergenic
1104364101 12:128161537-128161559 AGAATTATTGTGATCATTAAAGG + Intergenic
1105036010 12:132921737-132921759 AGCACTACTGTGAAGCCTAACGG + Exonic
1105064668 12:133186046-133186068 AGGGCTACTGTGAAGTTTTAAGG - Intronic
1105253182 13:18719689-18719711 AGGATTGTTCTGAAGATTAGAGG + Intergenic
1106117298 13:26828900-26828922 AGGATTGTTGTGAAGTTCAAAGG - Intergenic
1106255788 13:28020901-28020923 AGGCCTGATGTGAAGATAAAAGG + Intronic
1106305213 13:28503679-28503701 AGGGTTGTTGTGAGGATTAAAGG + Intergenic
1106437426 13:29735803-29735825 AGGACGACTGTGGTGATTAAAGG - Intergenic
1106687821 13:32080358-32080380 AAGGTCATTGTGAAGATTAAAGG - Intronic
1106764272 13:32898156-32898178 AGGAGTGTTGTGAGGATAAAAGG - Intergenic
1106861152 13:33910367-33910389 AGGACTATGGTGAAGATTGAAGG + Intronic
1107096474 13:36542892-36542914 AGGATTTTTCTGAATATTAAAGG + Intergenic
1108251633 13:48573523-48573545 AGGAGTATTGTGAGGATTAAAGG + Intergenic
1108275915 13:48809485-48809507 AGGGCTATTGTGAGGATTAGAGG + Intergenic
1109195481 13:59373545-59373567 AGGGCTGTTGTTAAGATTAAAGG - Intergenic
1109326716 13:60876734-60876756 AGGATTTCTGTGAAGCTTAAGGG - Intergenic
1110040230 13:70745675-70745697 AGAAATGTTGTGATGATTAAAGG + Intergenic
1110190256 13:72722298-72722320 AGGATTAGTGTGAGAATTAAAGG + Intronic
1110427567 13:75385722-75385744 AGGATAGTTGTGAGGATTAAAGG - Intronic
1110573989 13:77035598-77035620 AGGGTTATCGTGAAAATTAAAGG + Intergenic
1110920043 13:81072850-81072872 AGGACTATTGTGACCTGTAATGG + Intergenic
1111187889 13:84764597-84764619 AGAATTACTGTGAAGATTAAAGG - Intergenic
1111934353 13:94544225-94544247 AGGATTATTGACAAGTTTAATGG + Intergenic
1112094939 13:96122082-96122104 AGGGTTATTTTGATGATTAAAGG - Intronic
1112442672 13:99435513-99435535 AGGTCCTTTGTGAATATTAAGGG + Intergenic
1112453976 13:99541000-99541022 GGGATTGTTGTGAGGATTAAAGG + Intronic
1112739882 13:102460666-102460688 AAGAATTTTGAGAAGATTAAAGG - Intergenic
1112841728 13:103587537-103587559 AGGAATATAGTGAAAATCAAAGG + Intergenic
1113547541 13:111165901-111165923 AGGGATATTTTGTAGATTAAAGG + Intronic
1114829005 14:26115890-26115912 TGTACTATTGAGAATATTAAAGG - Intergenic
1115165228 14:30440608-30440630 AAGATTTTTGTGAAGATCAAAGG + Intergenic
1116136469 14:40930157-40930179 GGCACTATTGTGAACATTGAAGG + Intergenic
1116397925 14:44469664-44469686 AGGAATATTTTGAAGATTGATGG + Intergenic
1116972089 14:51076703-51076725 AGGACTGTTGCGAAGATGAAAGG - Intronic
1117001086 14:51372097-51372119 AGAGTTATTGTGAGGATTAAGGG + Intergenic
1117432527 14:55682607-55682629 AGGGTGGTTGTGAAGATTAAAGG - Intronic
1117868073 14:60170067-60170089 TGGATTATTGTGAAGATTAAGGG - Intergenic
1119800667 14:77442209-77442231 AGGGTTATTATGAAGATGAAGGG - Intronic
1120873518 14:89358947-89358969 AAGATTGTTGTGAGGATTAAAGG + Intronic
1121173670 14:91874626-91874648 AGGATTCTTGTGAAGATTAAAGG + Intronic
1121305794 14:92906254-92906276 AGGGCTGTTGTGGGGATTAAAGG + Intergenic
1123967186 15:25470821-25470843 AGGACTATTGGGAAAATTTGAGG + Intergenic
1124050920 15:26197100-26197122 AGGACTAGTGTGGAGAGCAAGGG - Intergenic
1125122189 15:36174685-36174707 AGAAATATTGTGAGGATGAAAGG - Intergenic
1125502701 15:40249440-40249462 AGGGTTCTTGTGAAGACTAAGGG + Intronic
1125955654 15:43789311-43789333 AGGATTATTGTGTAGGTAAAGGG - Intronic
1127263173 15:57340503-57340525 AGGATTCTTGTGAGGATTACAGG - Intergenic
1127615565 15:60682146-60682168 AAGACTGTTGTGAAAATTAAAGG + Intronic
1127910196 15:63410506-63410528 AGGAATATTGTACAAATTAAAGG - Intergenic
1128529994 15:68438371-68438393 AGGGCTGTCATGAAGATTAAAGG - Intergenic
1128674480 15:69598534-69598556 AGGACTGTTGTGGATATTCAGGG + Intergenic
1128916327 15:71566434-71566456 AGGGCTCTGGTGGAGATTAAAGG - Intronic
1129020369 15:72511655-72511677 AGGAATTTTTTGTAGATTAATGG + Intronic
1129208256 15:74050192-74050214 AGGACAGTTGGGAAGATTAAAGG - Intergenic
1130005278 15:80090460-80090482 AGGGATATTGTGAAGATGAAAGG + Intronic
1130006882 15:80108074-80108096 AGGACTATTATGAGGATTAAAGG + Intronic
1130082997 15:80751033-80751055 AAGACTCTTGTAAAGATGAAGGG - Intronic
1130101542 15:80898326-80898348 GGGATTGTTGTGAGGATTAAAGG + Intronic
1130148533 15:81293645-81293667 AGGGCTATTGTGAGGATTAAAGG + Intronic
1130993967 15:88893984-88894006 AACACTCTCGTGAAGATTAAGGG + Intronic
1131062491 15:89412519-89412541 AGGAGTTGTGTGAAGAGTAAAGG + Intergenic
1131183382 15:90255655-90255677 AGGAGGATTGGGAAGGTTAAGGG - Intronic
1131500080 15:92954207-92954229 AAGACTATCATGAAGATTACAGG - Intronic
1131995907 15:98132722-98132744 TGGAGCATTTTGAAGATTAAGGG + Intergenic
1133520507 16:6551419-6551441 AGAGCTATTGTGAAAACTAAAGG + Intronic
1133579349 16:7128263-7128285 AGAATTATTGTGAGGATTCAAGG - Intronic
1133927059 16:10201830-10201852 AGGGCTGTTTTGAGGATTAAAGG - Intergenic
1134510655 16:14844283-14844305 AAGATAATTGTGAGGATTAAAGG + Intronic
1134698293 16:16242769-16242791 AAGATAATTGTGAGGATTAAAGG + Intronic
1134973543 16:18551908-18551930 AAGATAATTGTGAGGATTAAAGG - Intronic
1135042777 16:19130725-19130747 AGGACTATTGCAATGATCAAAGG - Intronic
1135052326 16:19203165-19203187 AGGGTTGCTGTGAAGATTAAAGG + Intronic
1135065742 16:19308222-19308244 AAGACTGCTGTGAGGATTAAAGG + Intronic
1135927260 16:26706394-26706416 CAAAGTATTGTGAAGATTAAAGG + Intergenic
1136045744 16:27613659-27613681 AGGGCTTCTGTGAAGATCAAAGG + Intronic
1137717237 16:50605419-50605441 AGGGCTGTTGTGATGATTCAGGG + Intronic
1138236801 16:55390353-55390375 ATGGATATTGTGAGGATTAAAGG + Intronic
1138314381 16:56056213-56056235 AGGACCATTGTGAACCTGAAGGG + Intergenic
1138732164 16:59207226-59207248 AGCATTATTGTGATGATTAAAGG + Intergenic
1139075953 16:63448246-63448268 AGAGCTGTTGTGAAGATTTAAGG + Intergenic
1140614208 16:76640534-76640556 AGTACTATTGTGACTATTCAGGG + Intergenic
1140691124 16:77484884-77484906 ATGACTATTGTGAATATCTAGGG - Intergenic
1140720109 16:77763962-77763984 AGGACTATCGTGAGGACTGAGGG + Intergenic
1140741386 16:77944585-77944607 AAAATTGTTGTGAAGATTAAAGG + Intronic
1141800668 16:86306497-86306519 GGAACTCTTGTGAACATTAAAGG + Intergenic
1143273831 17:5695383-5695405 AGGGTTATTGTGAAGATAAATGG - Intergenic
1144090949 17:11855943-11855965 GGGACTATTATGAGAATTAAAGG + Intronic
1144208847 17:12998115-12998137 AGGATTAATGTAAAAATTAAAGG + Intronic
1144213956 17:13038354-13038376 AGGACGATTGTGCATATGAAGGG + Intergenic
1145030115 17:19498621-19498643 AGGGTTATTGTAAGGATTAAGGG - Intronic
1146775984 17:35616963-35616985 AGGATTGTTGTGAATATTAAAGG + Intronic
1146813064 17:35918929-35918951 AGGTATATGGTGCAGATTAATGG + Intronic
1147249559 17:39144934-39144956 GGGATTATTGTGGGGATTAAGGG - Intronic
1148081571 17:44969911-44969933 TGGACTGATGTGAAGATCAAGGG - Intergenic
1148328870 17:46801076-46801098 AGGGCTATTGTGAGGATGAAAGG - Intronic
1148799205 17:50212538-50212560 AGAGCTGTTGTGAGGATTAAAGG - Intergenic
1148875757 17:50686260-50686282 AGGACCATGGTAAAGATTAAAGG - Intronic
1149853290 17:60054566-60054588 AGGACTATTTTGGAGCTTTAAGG + Intronic
1150556270 17:66257435-66257457 ATGGCTATTGTGAGGATTAAAGG - Intergenic
1151981201 17:77510315-77510337 GGGACTATTGTGAACATTCAGGG - Intergenic
1153043811 18:837838-837860 AGGACTGTTGCGAAGGTTAAAGG + Intergenic
1153435778 18:5066638-5066660 AGGACTGGTGTGAAGATTGCAGG - Intergenic
1153596506 18:6730337-6730359 AGGAGTATTCTGAGGATTTAGGG - Intronic
1155036899 18:22032181-22032203 AGGATTCTTATAAAGATTAAAGG + Intergenic
1156148432 18:34214554-34214576 AGGACTATTGTGAAGATTAAAGG + Intronic
1156406523 18:36787773-36787795 AGGAATGTTGTGAGAATTAAAGG + Intronic
1157584020 18:48790032-48790054 GGGGCCATTGTGAAGATGAAAGG + Intronic
1157887451 18:51382852-51382874 AGGGTTATTGTGAAGATGAAAGG - Intergenic
1158529988 18:58251165-58251187 AGGATTGCTGTGAAGATTAAAGG + Intronic
1158898385 18:61937314-61937336 AGGGTTATTCTGAGGATTAAAGG - Intergenic
1158915083 18:62116692-62116714 AGTATTATTGTGGATATTAATGG - Intronic
1159664396 18:71140291-71140313 AGGAGCATTGAGAAGGTTAAGGG - Intergenic
1160447225 18:78937026-78937048 AGTATGATTGAGAAGATTAAAGG + Intergenic
1160954889 19:1686597-1686619 AGGCCTCTTGTGGGGATTAAAGG - Intergenic
1161867470 19:6843978-6844000 AGGGCTTTTGTGAAGATTAAAGG - Intronic
1162299988 19:9838994-9839016 AGGACCATTGTGAAGGTTCAAGG + Intronic
1162785185 19:13030397-13030419 AGGACAATTGTTATGATTTAGGG + Intronic
1163242991 19:16075953-16075975 AGGACTCTTGTGAATATTGGGGG + Intronic
1163781456 19:19251369-19251391 TGGGCTATTGAGAAGATTCAAGG - Exonic
1165753205 19:38274288-38274310 AACATTGTTGTGAAGATTAAAGG - Intronic
1166262084 19:41647328-41647350 AGACATGTTGTGAAGATTAAAGG - Intronic
1166289041 19:41850106-41850128 AGGGCTACTGTGAGGATTATGGG - Intronic
1167257674 19:48441032-48441054 AGGGCTATGGTGAGGAGTAAAGG + Intronic
1168488050 19:56781694-56781716 AGGCCTAGTGTGAGGATTAAAGG + Intronic
926801403 2:16664059-16664081 GGGGCTATTGTGAAGATGAAAGG + Intronic
927584764 2:24292035-24292057 AGGGTTATTGTAAAGATTAAAGG + Intronic
927684324 2:25160370-25160392 AGGGTTATTGTGAAGATTAAAGG - Intergenic
927854302 2:26518282-26518304 AGGACTATTCTGAGGATTAAAGG - Intronic
927866725 2:26592879-26592901 ATGATTATTGTGATGATTAATGG + Intronic
928758086 2:34549545-34549567 AGGACTATGTGGAAGACTAAGGG - Intergenic
928767714 2:34667782-34667804 AGGCTTGTTGTGAGGATTAAAGG + Intergenic
928783854 2:34857487-34857509 TGGTCTATAGTGCAGATTAAAGG - Intergenic
930683507 2:54283462-54283484 AGGAGTGTTGTGAAGATGAAAGG - Intronic
931267908 2:60676742-60676764 AGGAGTATTTTGAAAATTCAGGG - Intergenic
931660293 2:64555140-64555162 AGAACTTTTGTGAATATAAAAGG + Intronic
932024357 2:68118644-68118666 AGGACTCTTAGGAAGATTTAGGG - Intergenic
932468927 2:71941382-71941404 AGGACTATTGTGGGTATTAAAGG - Intergenic
933770881 2:85743256-85743278 AGGGTTGTTGTGAGGATTAAAGG - Intergenic
936261354 2:110962137-110962159 AGGGCTGTTGTGAGGATTAAAGG + Intronic
937440271 2:121909200-121909222 AGGACATTTGGGAAAATTAATGG - Intergenic
937458722 2:122067086-122067108 AGTACTATTGGGAAGATGGATGG + Intergenic
937859834 2:126698947-126698969 AGGATTATTTCGAGGATTAAAGG - Intergenic
937894844 2:126971026-126971048 AGGGTTACTTTGAAGATTAAAGG + Intergenic
939268021 2:139900731-139900753 AGGAATATTGTGAGGATTAAGGG - Intergenic
939358295 2:141133520-141133542 AAGTTTATTGTGAAGATTAAAGG + Intronic
939508791 2:143081368-143081390 AGGACTATTGTGAAGATTAAAGG - Intergenic
939709866 2:145504218-145504240 AGGACTATTTTGAAGACCAAAGG + Intergenic
940141097 2:150491328-150491350 AGTGCTATTGTGCAGCTTAAAGG - Intronic
940411852 2:153373669-153373691 AAGAATATTCTGAAGATGAATGG - Intergenic
940600666 2:155855367-155855389 AGGACTGATGTGAAGACTAGAGG - Intergenic
940932619 2:159452384-159452406 AGGGTTCTTGTGAGGATTAAAGG - Intronic
941071897 2:160964856-160964878 AGGGCTATTGTGAGGATTAAGGG - Intergenic
941288043 2:163639392-163639414 AGCTTTATTGTGCAGATTAAAGG + Intronic
941926615 2:170901778-170901800 AGCACTATTGTGATGATAAGTGG - Intergenic
942584754 2:177463319-177463341 AGAATTATTGTGAGGAGTAAAGG + Intronic
942824059 2:180152574-180152596 AGGAATGTTCTGAAGAGTAAAGG - Intergenic
943039941 2:182792473-182792495 GGGACTTTTGTGAACATTGAGGG - Exonic
943176583 2:184482502-184482524 AGCATGATTGTGAAGATGAAGGG + Intergenic
944665703 2:201957191-201957213 TGGGTTATTGTGAGGATTAAAGG - Intergenic
944838168 2:203600134-203600156 ATGGTTATTGTGAGGATTAAAGG + Intergenic
944987408 2:205193367-205193389 AGGACATTTGGGAAGATAAATGG - Intronic
945138909 2:206662705-206662727 AGGTCTGTTGTGAGTATTAAAGG - Intronic
946201720 2:218074351-218074373 AGGGATATTGTGAGGATGAACGG + Intronic
946281533 2:218669352-218669374 AGGGTTATTGTGAGGATAAAAGG + Intronic
946412966 2:219524470-219524492 AGGAGTTTTGTGAGGGTTAAGGG + Intronic
946493128 2:220169546-220169568 AGCACTATTGTTTAGATCAAGGG + Intergenic
946536442 2:220634959-220634981 AGTGCTATTGTGAAGATGAAAGG + Intergenic
947931268 2:233967144-233967166 AGGGTTATTGTGAAGATTTAAGG + Intronic
947991434 2:234490864-234490886 ATAACTGATGTGAAGATTAAGGG - Intergenic
948274874 2:236700675-236700697 AGGACTGTTGTGGAAATTAAAGG - Intergenic
948741163 2:240046855-240046877 AGGACTGTAGTGAGGATTAATGG - Intergenic
949078393 2:242076109-242076131 AGGACTAGTGTGGAGATTTGGGG + Intergenic
1169696614 20:8394610-8394632 AGGGTTATTGTGAGGACTAAAGG + Intronic
1169767047 20:9158004-9158026 AGGGTTATCGTGAAGATAAATGG - Intronic
1169801824 20:9518446-9518468 AGGACTAAAGTGAAGGTAAACGG - Intronic
1170175632 20:13465888-13465910 GGGATTCTTGTGATGATTAAGGG + Intronic
1170333112 20:15237210-15237232 TGGACTATCATGAAAATTAAAGG + Intronic
1170758472 20:19226669-19226691 AGAGTTATTGTGGAGATTAAAGG - Intronic
1171127128 20:22612166-22612188 AGGGCTGGTGTGAGGATTAAGGG - Intergenic
1173267193 20:41495164-41495186 TTGACTATTGTGAATAATAAAGG - Intronic
1173269140 20:41516130-41516152 AGGGCTGTTGTGAAGAGCAAAGG - Intronic
1173683137 20:44901306-44901328 GGGACTGTTGGGAAGATTACTGG + Intronic
1173935175 20:46855396-46855418 AAGGCTTTTGTGAGGATTAAAGG + Intergenic
1173948797 20:46974120-46974142 GGGGCTATTGGGAAGATTAAGGG + Intronic
1174316391 20:49705733-49705755 TGGACTATTGTGCAGATTCTAGG - Intronic
1176838687 21:13819574-13819596 AGGATTGTTCTGAAGATTAGAGG + Intergenic
1177646059 21:23900764-23900786 AGGAAAATGGTGGAGATTAATGG + Intergenic
1177821180 21:26032417-26032439 AGGTCTAGTGTGGTGATTAATGG + Intronic
1178961555 21:37071231-37071253 CTGACTGTTGTGAGGATTAACGG - Intronic
1181497540 22:23295952-23295974 AGGCCTCTTGTGAAGATGGAAGG - Intronic
1181994476 22:26864538-26864560 AGAACTGTTGTGAAGAGGAAGGG + Intergenic
1182002725 22:26934202-26934224 AAGGCTGTTGTGAAGATTAAAGG + Intergenic
1182130447 22:27846362-27846384 AGGGTGATTGTGAAGATTAGAGG + Intergenic
1182228996 22:28822177-28822199 AAGGTAATTGTGAAGATTAAAGG + Intergenic
1182433535 22:30315375-30315397 AGGAGTATTGTTAGGATTAAGGG - Intronic
1182674846 22:32030933-32030955 AGGGGTATTGTGAGGATTAAAGG - Intergenic
1182752911 22:32656024-32656046 AGGATTATTGTGAAAATGAGAGG + Intronic
1183001747 22:34865794-34865816 AAGATTATTGTGATGATTGATGG + Intergenic
1183006467 22:34906926-34906948 TAGATTATTGTGAGGATTAAAGG - Intergenic
1183322486 22:37173588-37173610 TGGGCTGTTGTGAGGATTAAAGG - Intronic
1183659239 22:39208689-39208711 TAGACTATTGTGAGGATTAAAGG - Intergenic
949149311 3:745615-745637 AGTAGGGTTGTGAAGATTAAAGG - Intergenic
949189297 3:1232546-1232568 AGGGTTATTGTGAGGATCAATGG - Intronic
949418835 3:3843129-3843151 AGGATTATTGAGAAAATTAAGGG - Intronic
949790596 3:7787772-7787794 AGAGCCATTGTGAAGAGTAATGG - Intergenic
950941003 3:16891298-16891320 AGCATTGTTGTAAAGATTAAAGG + Intronic
951027187 3:17842801-17842823 ATGACTATGGTCAAGATTTATGG + Intronic
951244005 3:20318868-20318890 AGGGTTATTGTAGAGATTAAAGG + Intergenic
952077903 3:29720409-29720431 AGGGTTACTGTAAAGATTAATGG - Intronic
952539786 3:34355881-34355903 TGGGCTGTTGTGAAGATTCATGG + Intergenic
953227254 3:41032164-41032186 AGGGCTATTGTGAGGATTAAAGG - Intergenic
953228313 3:41041321-41041343 AGAACTATTGCAAAGATTAAGGG - Intergenic
953266474 3:41394018-41394040 AGGGATGTTGTCAAGATTAAAGG + Intronic
953611376 3:44450240-44450262 TGGATTATTGTAAAGATTAAAGG - Intronic
953763070 3:45709129-45709151 AGGGCTGTTGTGAAGATTAAAGG + Intronic
955018074 3:55090949-55090971 AGGATGATTGTAAAGAGTAAAGG + Intergenic
955090940 3:55749789-55749811 AGGTTTATTGTGAAGAGTGAAGG - Intronic
955133377 3:56192017-56192039 GGAACAACTGTGAAGATTAAAGG - Intronic
955141930 3:56278054-56278076 AGGGTTGTTGTGAGGATTAAAGG + Intronic
955194989 3:56796870-56796892 AGGATTACTGTGATGATGAAAGG + Intronic
955475101 3:59328482-59328504 AGGGCTGTTCTGAAAATTAAGGG - Intergenic
956069360 3:65431415-65431437 ATGACTATTTTCAAAATTAAGGG + Intronic
956228933 3:66991070-66991092 AGAACTATTATGAGGAGTAAAGG - Intergenic
956507236 3:69955092-69955114 AGGAATGCTGTGAAGATTCATGG + Intronic
956704454 3:71987424-71987446 AGCATCATTATGAAGATTAAGGG - Intergenic
956782696 3:72616866-72616888 AGGACTTTTATGAGGATTACAGG + Intergenic
956855169 3:73268970-73268992 AGGGTTGTTCTGAAGATTAAAGG + Intergenic
956855555 3:73271530-73271552 AAGAATATTGTGAGGATTAAAGG - Intergenic
956981188 3:74640490-74640512 AAGATTATAGTGAAGGTTAAAGG + Intergenic
957481577 3:80804796-80804818 AGGACTAGTGTAAATGTTAAAGG + Intergenic
957712622 3:83882383-83882405 AGGACTATAGTGATCATAAAAGG + Intergenic
957855513 3:85871605-85871627 TGAGCTATTGTGAAGATAAAAGG + Intronic
958964507 3:100543959-100543981 AGGTTTGTTTTGAAGATTAAAGG + Intronic
959329397 3:104983821-104983843 CGGACTATTTTGAGTATTAAAGG - Intergenic
960357477 3:116671318-116671340 TTGCCTATTGTGAAGATTACGGG - Intronic
960536228 3:118817330-118817352 TGGACTATTATGAAAATTAAGGG - Intergenic
960940117 3:122927966-122927988 CGGACTATTGAGAAGATCAATGG - Exonic
961122184 3:124382167-124382189 AGGGTTATTGCGAGGATTAAAGG + Intronic
961835967 3:129659911-129659933 AGGGCAATTGCAAAGATTAAAGG + Intronic
961916962 3:130386277-130386299 AGGCTTATTGTGAAGCTTAATGG + Intronic
962060564 3:131922754-131922776 AAGACTATTGTGAGAATTAGAGG + Intronic
962195987 3:133364067-133364089 TGGATTATTGTGAAGACTAAAGG - Intronic
962263231 3:133927900-133927922 AGGGCTGTCGTGAAGATTCAAGG + Intergenic
962593474 3:136915252-136915274 AGTCCTATTGAGAAGATAAAAGG + Intronic
962679004 3:137779666-137779688 AGGATTATTTTGAGGATTAAAGG + Intergenic
964814785 3:160705263-160705285 AAGACTCTTGTGAAGATTAAAGG + Intergenic
965403198 3:168238095-168238117 AGGGCTACTGTGAAGATAAATGG + Intergenic
965465344 3:169023080-169023102 ATGATTTTTGTGAAAATTAAAGG + Intergenic
965608773 3:170523136-170523158 AGGATTGTTGTCAAGACTAAAGG - Intronic
965612355 3:170557734-170557756 AGTATTATTGTAAGGATTAAAGG + Intronic
966332901 3:178834952-178834974 AGGGCCATGGTGAAGATTCAAGG + Intronic
966363769 3:179159514-179159536 AGTGTTATTGTGAGGATTAAGGG - Intronic
966433381 3:179856171-179856193 AGCACTGCTGTGATGATTAAAGG + Intronic
966895081 3:184438907-184438929 AGGACTACTTGGAAGAATAAGGG - Intronic
966996832 3:185290724-185290746 TGGACTGTTGTGAGGATTAAAGG + Intronic
967417593 3:189235889-189235911 AGGGTTCTTGTGAAGATTAAAGG + Intronic
967620537 3:191628207-191628229 AGGAATATTGTAAGGATTATGGG + Intergenic
967757805 3:193189820-193189842 TTGACTTTTTTGAAGATTAAAGG - Intergenic
969116167 4:4871989-4872011 TCGACTTTTGTGAGGATTAAGGG - Intergenic
969386993 4:6858775-6858797 AGGGCTGTTGTGAATATTAAAGG - Intronic
970172286 4:13301941-13301963 AAGACTATTGTGAGGATTAAAGG + Intergenic
970571390 4:17386701-17386723 TGGATTATTGTAAACATTAAAGG - Intergenic
970635130 4:18001232-18001254 AAGATTATTGTGAGGATTAAAGG + Intronic
970915823 4:21333454-21333476 AGTGCTATTGTGAATATTAAAGG - Intronic
970916544 4:21342409-21342431 ATGAGTTTTTTGAAGATTAAAGG - Intronic
971217365 4:24673746-24673768 AGGGTTGTTGTGAAAATTAAAGG + Intergenic
971271273 4:25148435-25148457 AGGACTATTGAGATGAATTAAGG + Intronic
971501345 4:27321445-27321467 GGGGATATTGTTAAGATTAAAGG - Intergenic
971919310 4:32915962-32915984 AAGACTATTGTGAGAAGTAAAGG + Intergenic
973209608 4:47601202-47601224 AGGAGTATTGTAAAGATTAAAGG - Intronic
973684760 4:53358024-53358046 AAAATTATTGTGAAAATTAAAGG + Intronic
974146040 4:57948734-57948756 AGGATTATTGTAAAGATCAAAGG + Intergenic
974431251 4:61799262-61799284 AGAATTATTGTGAATAGTAAAGG - Intronic
974441703 4:61926642-61926664 TGGGTTATTGTGAAAATTAAAGG + Intronic
974882446 4:67776324-67776346 AGGACTATAATGAAGATTGCTGG + Intergenic
975210497 4:71694216-71694238 AGGGCTATGGTGAGGATGAAAGG + Intergenic
975237678 4:72019062-72019084 TAGACTATTATGAAGACTAATGG + Intergenic
975346923 4:73302213-73302235 AGGTTTGTTGTAAAGATTAAAGG - Intergenic
975619113 4:76277710-76277732 AGGGCTGTTGTGAAGATTAAAGG - Intronic
975802097 4:78070876-78070898 AGGACTGTTGTGAAGCTTAAAGG + Intronic
975886448 4:78971814-78971836 AGGACTATACTGAAGACTGAGGG - Intergenic
976141647 4:81999365-81999387 AGGAATAATGGGAAGATTCAAGG + Intronic
976194100 4:82516528-82516550 AGGGCTGTGGTGAAGATTAAGGG + Intronic
976468814 4:85403141-85403163 AGGTTTATTGTGAAGATTATTGG - Intergenic
977738804 4:100451878-100451900 AGGATCTTTGTGAAGATTAAGGG - Intronic
977740183 4:100470596-100470618 AGCACTATTCAGAAGAGTAAAGG + Intronic
977861811 4:101970193-101970215 AGGACTGTTGTGAAGATTCGAGG + Intronic
978382723 4:108146937-108146959 AGGACTGTTGTGTAGACTAAGGG - Intronic
979659284 4:123234926-123234948 CGGGCTGTTGTGCAGATTAAAGG + Intronic
980598022 4:134981265-134981287 AGGACTATTGTGTATAGGAAAGG + Intergenic
980816923 4:137959721-137959743 AGTACTGATGTGAAGGTTAAAGG + Intergenic
981044268 4:140251970-140251992 AGGTTTTTTGTGATGATTAAGGG - Intergenic
981059225 4:140403313-140403335 AGGATTGTTATGATGATTAAAGG + Intronic
981179244 4:141719217-141719239 ACCATTATTGTAAAGATTAAAGG + Intronic
981584314 4:146284787-146284809 AGGCCTACTGTGAGGAATAAAGG - Intronic
981612144 4:146605485-146605507 AGGATTTTTGTGAGGATTAAAGG + Intergenic
981955072 4:150461571-150461593 AGGGATTTTGTGAAGGTTAAAGG + Intronic
982164524 4:152602894-152602916 AGGTCGATTGTGAGAATTAAAGG + Intergenic
982958951 4:161810997-161811019 AGAAGTTTTGGGAAGATTAAAGG - Intronic
983480419 4:168266876-168266898 AAGATTGTTGTGATGATTAAAGG - Intronic
983590729 4:169408342-169408364 AGGAGTACTGTGAACATGAAGGG - Intronic
985176149 4:187204197-187204219 ATGGCTATTATGAAGATTAAAGG - Intergenic
986054660 5:4124307-4124329 AGGACTTGTCTGAAGATAAAAGG + Intergenic
989155978 5:38345250-38345272 AGAGTTGTTGTGAAGATTAAAGG + Intronic
989264974 5:39463140-39463162 AGGTTTGTGGTGAAGATTAATGG - Intergenic
991431628 5:66553774-66553796 AGGGGTATTGAGAGGATTAAAGG - Intergenic
991661422 5:68954692-68954714 GGGATTATTGTGAGGATCAAAGG - Intergenic
992063153 5:73077336-73077358 AGGTGTATTGTGAAGATCACTGG + Exonic
992357903 5:76004424-76004446 AGGATTATTGTCAGGATTAGAGG + Intergenic
993572766 5:89562661-89562683 AGTACTCTTGGGAAGATGAAAGG - Intergenic
994183174 5:96789851-96789873 AGGTTTATTATGAAGAGTAAAGG + Intronic
994333388 5:98534422-98534444 AGGGTTACTATGAAGATTAAAGG + Intergenic
994435391 5:99723919-99723941 AGGACTCTGGTGAAGATTTCTGG - Intergenic
994668465 5:102736697-102736719 AGGATTGGTGTGAAAATTAAAGG - Intergenic
994786017 5:104164449-104164471 TGGATTGTTGAGAAGATTAAAGG - Intergenic
995923876 5:117345352-117345374 AGGAATTTTGTAAAAATTAAAGG - Intergenic
996548718 5:124708031-124708053 AGGAATGTTGTGAGAATTAAAGG - Intronic
996699124 5:126431794-126431816 AGGAATATTATGCAGGTTAATGG - Intronic
996833662 5:127767661-127767683 AGAACTTTTTTGAAGATTAAAGG + Intergenic
996916478 5:128718365-128718387 AGGACTATTGTTAAAATTCCAGG - Intronic
997277922 5:132613574-132613596 AAGACTATTGTGAAGATTAAAGG - Intronic
997390350 5:133510079-133510101 AGGGTTATTCTGAGGATTAAAGG - Intronic
997417416 5:133739739-133739761 GGTATTATTGTAAAGATTAAAGG - Intergenic
998883516 5:146669699-146669721 AGGATTTTTGTGAAGCTTAAAGG - Intronic
999253725 5:150197514-150197536 AAGGTTGTTGTGAAGATTAAAGG + Intronic
999923694 5:156351510-156351532 AGGATTGTTGTAAAGATTAGAGG + Intronic
1000112248 5:158120160-158120182 AGGGCTATTGTAAGAATTAAAGG - Intergenic
1000290861 5:159869805-159869827 AGAGTTATTGTGAAGATAAAAGG + Intergenic
1000918932 5:167115975-167115997 AGGACTGTTGTGAGAATTAAGGG + Intergenic
1001144926 5:169175508-169175530 AGGATAATTATGAAGATTAAAGG + Intronic
1001193695 5:169653123-169653145 AGGAGTGTTGTGAGAATTAAAGG + Intronic
1001408753 5:171495495-171495517 AAGATCATTGTGAAGATTCAAGG - Intergenic
1001511641 5:172327258-172327280 AGAATCGTTGTGAAGATTAATGG - Intronic
1003723672 6:8734545-8734567 AGGGTTACTGTAAAGATTAACGG - Intergenic
1003771883 6:9313835-9313857 AGGATTATCATAAAGATTAAAGG - Intergenic
1004592438 6:17066513-17066535 AGGGTCATTGTGAGGATTAAAGG - Intergenic
1005186660 6:23170261-23170283 AAGCCTATTGTGAAGAAAAAAGG + Intergenic
1007340083 6:41185901-41185923 AGGGTTGTTGTGAAGATTCAAGG - Intergenic
1007935862 6:45731305-45731327 AGGAATAATGTGAAGATCAGAGG + Intergenic
1008473064 6:51905934-51905956 AGAATTATTGTGAAAATTACTGG + Intronic
1010418715 6:75646461-75646483 AAGTTTATTGTGAGGATTAAAGG + Intronic
1010639909 6:78312132-78312154 AGAACTGTTGCAAAGATTAAAGG - Intergenic
1010931827 6:81812988-81813010 GTGACTCTTGTGAAGATGAAAGG + Intergenic
1011071487 6:83390257-83390279 AGGAACATAGTGAAAATTAAGGG - Intronic
1011366306 6:86586037-86586059 TGTAGCATTGTGAAGATTAAAGG - Intergenic
1012416005 6:99014610-99014632 AGATTTATTGTGAAGATTAATGG - Intergenic
1012449832 6:99343474-99343496 AAGGTTATTATGAAGATTAAAGG - Intronic
1013021499 6:106225132-106225154 AGGGTTATTGTGAAAATTAGAGG - Intronic
1013472129 6:110475375-110475397 AAGGCTGTAGTGAAGATTAAAGG + Intronic
1013654913 6:112236384-112236406 AAGATGGTTGTGAAGATTAAAGG + Intronic
1013755291 6:113454532-113454554 ATGACTGTTGTAAAAATTAATGG - Intergenic
1014245929 6:119068452-119068474 AGAATTATTATAAAGATTAAAGG - Intronic
1014576841 6:123083563-123083585 AGGATTTTTGTGACTATTAAAGG + Intergenic
1014819567 6:125972179-125972201 AGGACAAGAGTGAAGATCAATGG + Intronic
1015262049 6:131249155-131249177 AGAAATATTGTGAAGATCTATGG - Intronic
1015792002 6:136973121-136973143 AAGCTTATTGTGAAGAATAATGG + Intergenic
1015828232 6:137338749-137338771 AGGATTTTTGTGAAGACTGAGGG + Intergenic
1017265334 6:152439063-152439085 AGGACTGTTTTGAGGATTAAAGG + Intronic
1017546747 6:155460217-155460239 AGTACTAAGGTGAACATTAATGG + Intergenic
1019836267 7:3387561-3387583 AGGTCTGTTGTGAGGATAAATGG + Intronic
1020393112 7:7682075-7682097 AACACTATTGTAGAGATTAAAGG + Intronic
1020878712 7:13731069-13731091 AGGCCTATAATGAGGATTAAAGG + Intergenic
1021404137 7:20244759-20244781 AGGTTTCTTGTGAGGATTAAAGG + Intergenic
1021781588 7:24112211-24112233 GTGACTATTGTGAAGTTTAGAGG + Intergenic
1021975648 7:26008822-26008844 TTGACTATTATGCAGATTAAGGG - Intergenic
1022235978 7:28460709-28460731 AGGGTTACTGTGAGGATTAAAGG + Intronic
1022624804 7:32024343-32024365 AAGGCAATTGTGAAAATTAAAGG + Intronic
1022864098 7:34399415-34399437 AGGATTATTGTGAAAGTCAAGGG - Intergenic
1023225759 7:37967188-37967210 AGGGCCATTGTGAAGAATAAAGG - Intronic
1024714471 7:52060023-52060045 ATGACATTTGTGAAGATTACAGG + Intergenic
1024926170 7:54618034-54618056 AGGCTTATTGTGAGGATGAAAGG - Intergenic
1025591785 7:62869686-62869708 AGGACTATGGTGGAGACCAATGG + Intergenic
1026116105 7:67497053-67497075 AGGGCCATTGAGAAGATCAAAGG + Intergenic
1026915661 7:74118786-74118808 GGGATTAGTGTGAGGATTAAAGG + Intronic
1027462405 7:78471376-78471398 TGGGCTGTTGTGGAGATTAAAGG + Intronic
1028126472 7:87118821-87118843 AGGACTGTTGTGAGGATTAAGGG + Intergenic
1030605578 7:111635938-111635960 AGGATTGTTGTGAAGATTAAAGG - Intergenic
1030908728 7:115219987-115220009 AGGGCTGTTGTAAAGATTAAAGG - Intergenic
1032601439 7:133300425-133300447 AGGGCTATTGTGAAGATTTCAGG - Intronic
1032839521 7:135703112-135703134 AGGACGATTGTTAATATCAAAGG - Intronic
1033562507 7:142545944-142545966 GGGACTTTTGTGAACATAAATGG - Intergenic
1034212816 7:149379974-149379996 AGGACTAATGTACAGAATAAAGG - Intergenic
1034840994 7:154396572-154396594 AGGATTGTAATGAAGATTAAAGG + Intronic
1034861688 7:154600546-154600568 AGGTTTCTTGTGAAGATTAAAGG - Intronic
1034982486 7:155487910-155487932 TTGGCTATTGTGAAGATTAAAGG + Intronic
1035134488 7:156687803-156687825 AGGGTTTTTGTGAAGATCAACGG - Intronic
1035937705 8:3860631-3860653 CGGATTATGGTGAAAATTAATGG - Intronic
1036045553 8:5135856-5135878 AAGATTAATGTAAAGATTAAAGG + Intergenic
1037063629 8:14547991-14548013 AGGACCTTTGTGAAGATGGAAGG + Intronic
1038203389 8:25438709-25438731 AAGATTTTTGTGAAGATTCACGG - Intronic
1038923294 8:32110021-32110043 AGAGCTATTGTAAGGATTAAAGG + Intronic
1039200971 8:35093743-35093765 TGGACTGGTGTGAGGATTAAAGG + Intergenic
1040457800 8:47616979-47617001 AGGACAATTTTGAGGATTACTGG + Intronic
1041203331 8:55472784-55472806 TGGAGTATTCTGAAGAATAATGG + Intronic
1041642656 8:60219485-60219507 AGGCCTAATGTGCAGATTTAGGG - Intronic
1041795204 8:61739502-61739524 TGCACCATTGTGAAGAGTAAGGG + Intergenic
1042354254 8:67809035-67809057 AGGGTTGTGGTGAAGATTAAAGG - Intergenic
1042520859 8:69709980-69710002 AGGACTCTGGTGAGGATTACAGG - Intronic
1042604773 8:70534458-70534480 AGGAGTACTGTGAAAATTAAAGG - Intergenic
1043019924 8:74987433-74987455 AGGATTATTGTGAAGATAGAAGG + Intronic
1043377173 8:79663414-79663436 AAGATTATTGTGAGGATTAAGGG + Intronic
1043795723 8:84535924-84535946 AGAACAATTCTGAAAATTAATGG - Intronic
1043924566 8:86022237-86022259 AGCATTTTAGTGAAGATTAAAGG - Intronic
1044406956 8:91838364-91838386 AGGAATACTCTGATGATTAATGG - Intergenic
1044419547 8:91978327-91978349 AGCACTGCTGTGAAGATTGAAGG + Intronic
1044641513 8:94387237-94387259 AGGAAAAAGGTGAAGATTAACGG + Intronic
1045558439 8:103237490-103237512 GGGTGTATTGTGAAGATAAAGGG + Intergenic
1045959096 8:107946173-107946195 AGGGCTGTTATGAGGATTAAAGG - Intronic
1045969663 8:108065443-108065465 ATGCCTATTGAGAGGATTAAAGG - Intronic
1046284515 8:112077185-112077207 AGGACTATGTTGAATATAAACGG + Intergenic
1046550439 8:115709079-115709101 AGTGCTATTGTAAGGATTAAAGG + Intronic
1046818146 8:118607889-118607911 AGGAAGATTTTGAAGATAAAAGG - Intronic
1046886450 8:119372571-119372593 AGGAGTATTGGGAGGATTAAAGG - Intergenic
1047170736 8:122490119-122490141 TGGGCTCTTGTGAAGATTAGAGG - Intergenic
1047284725 8:123477918-123477940 AGGGCTGTTGTGAAGATTACAGG + Intergenic
1047417482 8:124676999-124677021 TGGACTATTGAGAATTTTAAAGG + Intronic
1047622465 8:126621842-126621864 AAGATTGTTGTGAGGATTAAAGG + Intergenic
1048949596 8:139484600-139484622 GGGACTTTTGTGAGGATTAAAGG + Intergenic
1050055768 9:1652348-1652370 AAAACTATTAGGAAGATTAAAGG + Intergenic
1050215814 9:3321921-3321943 AGGAATATTGTATATATTAAAGG - Intronic
1050268640 9:3918191-3918213 AGGACTATCCTGAATATTTAGGG + Intronic
1050584102 9:7092214-7092236 AGGATTACTGTGGTGATTAATGG - Intergenic
1050762318 9:9087782-9087804 AGGCATATTGTGAAAATGAAAGG - Intronic
1050856377 9:10362302-10362324 AGGATTGTTGTGAAGATCAATGG - Intronic
1050916883 9:11147392-11147414 AGGACAATTGTGAAAAAGAAGGG + Intergenic
1051101763 9:13530072-13530094 AAGACTTTTGTGAAAAGTAAGGG + Intergenic
1052342413 9:27377087-27377109 TGGGCTGTTGTGAGGATTAAAGG + Intronic
1052396352 9:27943361-27943383 ATGACTATTTTGCATATTAAAGG + Intergenic
1052435813 9:28427456-28427478 GGGATTATGGTGAGGATTAATGG - Intronic
1053102253 9:35380857-35380879 AGCACTAGTATGAAGATTAAAGG - Intronic
1053531399 9:38885406-38885428 ATGACTAATCAGAAGATTAAAGG + Intergenic
1054203623 9:62109835-62109857 ATGACTAATCAGAAGATTAAAGG + Intergenic
1054634739 9:67478529-67478551 ATGACTAATCAGAAGATTAAAGG - Intergenic
1055438150 9:76313062-76313084 AGAATTCTTGTGAGGATTAATGG - Intronic
1056259252 9:84831561-84831583 AGGAATGTTGTGAGGATTACAGG - Intronic
1057110388 9:92464414-92464436 AGGTGTACTGTGAAGACTAATGG - Intronic
1057745591 9:97748525-97748547 AGGGCTGTTGTGAAGGTTCAGGG - Intergenic
1058069473 9:100587006-100587028 AGGACTGTTGTGATGATCAAAGG + Exonic
1058500844 9:105614288-105614310 AGGACTGCTGTGAAGATTGAAGG - Intronic
1058508033 9:105686622-105686644 AGGACTATTGTTAAAGATAATGG - Intergenic
1058760287 9:108124081-108124103 AGGACTATGGTGAGGATTCTAGG + Intergenic
1059344310 9:113617671-113617693 AGGCTTATTGTGAGGATTAAAGG - Intergenic
1060082906 9:120668760-120668782 AGGATTATGGTGAACACTAAAGG - Intronic
1060507183 9:124206796-124206818 AGGGTTATTGTGAACATGAAAGG - Intergenic
1060745878 9:126130632-126130654 AGGACTGTTCTAAAGATGAAAGG + Intergenic
1060883006 9:127131756-127131778 AGAACTATTGTGAAGGTTCCTGG + Intronic
1062132151 9:134902982-134903004 AAGACTATTATCAAGAATAAAGG + Intergenic
1186052130 X:5608062-5608084 AGGCCTATTGTAAACATCAAAGG - Intergenic
1186216942 X:7310735-7310757 AGGGCAAGTGTGAAGATAAAGGG - Intronic
1186362557 X:8857496-8857518 AGGACTTTTGTGAGGTTTAAGGG - Intergenic
1186537446 X:10364717-10364739 AAGAATATTGTGCATATTAATGG + Intergenic
1186668573 X:11745175-11745197 AGGATTGTTGGAAAGATTAAAGG + Intergenic
1186860512 X:13667994-13668016 AGGGTAGTTGTGAAGATTAAAGG - Intronic
1187004070 X:15214371-15214393 GGGTCTGTTGGGAAGATTAAAGG + Intergenic
1187440320 X:19312181-19312203 AGGATTGTTGTGGGGATTAAAGG + Intergenic
1187630834 X:21169840-21169862 AAGGCTACTGTGAGGATTAAGGG + Intergenic
1187710895 X:22053002-22053024 AGGGATTTTGTGAAGATTAAAGG + Intronic
1189263186 X:39692596-39692618 AGGGCTGTTGTGAGCATTAAAGG + Intergenic
1189827587 X:44935529-44935551 AGGATTATTGTAAGAATTAAAGG - Intronic
1190455035 X:50618745-50618767 ATGGTTGTTGTGAAGATTAATGG - Intronic
1190731225 X:53227301-53227323 AAGACTGTTGCAAAGATTAAGGG - Intergenic
1191702271 X:64055398-64055420 AGGAGTATTGTGAGTAGTAAGGG - Intergenic
1191868760 X:65727534-65727556 AGGGGTATTATGAAAATTAAAGG + Intronic
1192478862 X:71467676-71467698 AAGGTTATTGTGAGGATTAAGGG - Intronic
1192611226 X:72569449-72569471 GGGACTTATGTGAAGATAAAAGG + Intronic
1193428475 X:81370318-81370340 AGGAATTTTATGAAAATTAAAGG + Intergenic
1193744851 X:85264849-85264871 AGGGCTGTTGTGAGGGTTAAAGG + Intronic
1194182402 X:90729255-90729277 TGGATTGTTGTGAGGATTAAAGG - Intergenic
1195317136 X:103690065-103690087 AGGCCTATTGTTGAGATTAATGG - Intergenic
1196343374 X:114623148-114623170 TGGAATGTTGTGAAAATTAAAGG - Intronic
1196349934 X:114716855-114716877 AGGACTAATCTGAACATTTATGG + Intronic
1196792530 X:119477199-119477221 AGGAATAGTGTGAAGATTAAAGG + Intergenic
1197194124 X:123680791-123680813 AGGACTATTCTGAAGTTTTTTGG - Intronic
1197540279 X:127751039-127751061 TGGGCTGTTGTGAAGGTTAAGGG + Intergenic
1197838026 X:130715853-130715875 AGAGCTATAGTGAAGATTAAAGG + Intronic
1197883622 X:131194669-131194691 AGAGCTGTTGTGACGATTAAAGG + Intergenic
1198458378 X:136839520-136839542 AGGACTATTCTGATGATTTGGGG + Intergenic
1198911431 X:141619314-141619336 GAGGCTATTGTAAAGATTAAGGG - Intronic
1198987589 X:142473704-142473726 AGGCTTAATGTGATGATTAAAGG + Intergenic
1199363473 X:146949649-146949671 GGGAGTATTGTGAATATGAAAGG - Intergenic
1199440601 X:147863780-147863802 AGGGCTATGGTGAAGATACAGGG + Intergenic
1199784436 X:151091686-151091708 AGGACTACTGAGGAAATTAAAGG + Intergenic
1199820297 X:151438957-151438979 AAGATTAGTGTGAAGATTAAGGG - Intergenic
1200529021 Y:4311213-4311235 TGGATTGTTGTGAGGATTAAAGG - Intergenic