ID: 939508794

View in Genome Browser
Species Human (GRCh38)
Location 2:143081388-143081410
Sequence GCCGACATCTGGCACCTGAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939508794_939508797 7 Left 939508794 2:143081388-143081410 CCTATCAGGTGCCAGATGTCGGC No data
Right 939508797 2:143081418-143081440 TAGCTACCCCAGTTAGGTGCAGG No data
939508794_939508796 1 Left 939508794 2:143081388-143081410 CCTATCAGGTGCCAGATGTCGGC No data
Right 939508796 2:143081412-143081434 CTTTTTTAGCTACCCCAGTTAGG No data
939508794_939508801 20 Left 939508794 2:143081388-143081410 CCTATCAGGTGCCAGATGTCGGC No data
Right 939508801 2:143081431-143081453 TAGGTGCAGGTCACTCTGCTAGG No data
939508794_939508802 24 Left 939508794 2:143081388-143081410 CCTATCAGGTGCCAGATGTCGGC No data
Right 939508802 2:143081435-143081457 TGCAGGTCACTCTGCTAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939508794 Original CRISPR GCCGACATCTGGCACCTGAT AGG (reversed) Intergenic
No off target data available for this crispr