ID: 939508796

View in Genome Browser
Species Human (GRCh38)
Location 2:143081412-143081434
Sequence CTTTTTTAGCTACCCCAGTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939508791_939508796 21 Left 939508791 2:143081368-143081390 CCTTTAATCTTCACAATAGTCCT 0: 2
1: 3
2: 29
3: 115
4: 492
Right 939508796 2:143081412-143081434 CTTTTTTAGCTACCCCAGTTAGG No data
939508794_939508796 1 Left 939508794 2:143081388-143081410 CCTATCAGGTGCCAGATGTCGGC No data
Right 939508796 2:143081412-143081434 CTTTTTTAGCTACCCCAGTTAGG No data
939508795_939508796 -10 Left 939508795 2:143081399-143081421 CCAGATGTCGGCTCTTTTTTAGC No data
Right 939508796 2:143081412-143081434 CTTTTTTAGCTACCCCAGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939508796 Original CRISPR CTTTTTTAGCTACCCCAGTT AGG Intergenic
No off target data available for this crispr