ID: 939508797

View in Genome Browser
Species Human (GRCh38)
Location 2:143081418-143081440
Sequence TAGCTACCCCAGTTAGGTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939508794_939508797 7 Left 939508794 2:143081388-143081410 CCTATCAGGTGCCAGATGTCGGC No data
Right 939508797 2:143081418-143081440 TAGCTACCCCAGTTAGGTGCAGG No data
939508795_939508797 -4 Left 939508795 2:143081399-143081421 CCAGATGTCGGCTCTTTTTTAGC No data
Right 939508797 2:143081418-143081440 TAGCTACCCCAGTTAGGTGCAGG No data
939508791_939508797 27 Left 939508791 2:143081368-143081390 CCTTTAATCTTCACAATAGTCCT 0: 2
1: 3
2: 29
3: 115
4: 492
Right 939508797 2:143081418-143081440 TAGCTACCCCAGTTAGGTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939508797 Original CRISPR TAGCTACCCCAGTTAGGTGC AGG Intergenic
No off target data available for this crispr