ID: 939508801

View in Genome Browser
Species Human (GRCh38)
Location 2:143081431-143081453
Sequence TAGGTGCAGGTCACTCTGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939508795_939508801 9 Left 939508795 2:143081399-143081421 CCAGATGTCGGCTCTTTTTTAGC No data
Right 939508801 2:143081431-143081453 TAGGTGCAGGTCACTCTGCTAGG No data
939508794_939508801 20 Left 939508794 2:143081388-143081410 CCTATCAGGTGCCAGATGTCGGC No data
Right 939508801 2:143081431-143081453 TAGGTGCAGGTCACTCTGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939508801 Original CRISPR TAGGTGCAGGTCACTCTGCT AGG Intergenic
No off target data available for this crispr