ID: 939513082

View in Genome Browser
Species Human (GRCh38)
Location 2:143131532-143131554
Sequence CTCTAAATTAGGAGCAGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939513082_939513084 -9 Left 939513082 2:143131532-143131554 CCTGCTCTGCTCCTAATTTAGAG No data
Right 939513084 2:143131546-143131568 AATTTAGAGTCCCATAGACTTGG No data
939513082_939513088 23 Left 939513082 2:143131532-143131554 CCTGCTCTGCTCCTAATTTAGAG No data
Right 939513088 2:143131578-143131600 AGATAGACCCTTCCATTCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939513082 Original CRISPR CTCTAAATTAGGAGCAGAGC AGG (reversed) Intronic
No off target data available for this crispr