ID: 939513802

View in Genome Browser
Species Human (GRCh38)
Location 2:143141127-143141149
Sequence TGGCAGCTTTAGATGTGGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939513797_939513802 10 Left 939513797 2:143141094-143141116 CCTGACCATGATGAGCTGTATGG No data
Right 939513802 2:143141127-143141149 TGGCAGCTTTAGATGTGGAGAGG No data
939513799_939513802 5 Left 939513799 2:143141099-143141121 CCATGATGAGCTGTATGGTGCAT No data
Right 939513802 2:143141127-143141149 TGGCAGCTTTAGATGTGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939513802 Original CRISPR TGGCAGCTTTAGATGTGGAG AGG Intronic
No off target data available for this crispr