ID: 939532538

View in Genome Browser
Species Human (GRCh38)
Location 2:143382327-143382349
Sequence AGGCAAGGCATGATTCCTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939532538_939532540 -10 Left 939532538 2:143382327-143382349 CCTGGAGGAATCATGCCTTGCCT No data
Right 939532540 2:143382340-143382362 TGCCTTGCCTCTCTGGTTTCTGG No data
939532538_939532544 21 Left 939532538 2:143382327-143382349 CCTGGAGGAATCATGCCTTGCCT No data
Right 939532544 2:143382371-143382393 TGCCAATCTTTGACAGTCCTTGG No data
939532538_939532542 -7 Left 939532538 2:143382327-143382349 CCTGGAGGAATCATGCCTTGCCT No data
Right 939532542 2:143382343-143382365 CTTGCCTCTCTGGTTTCTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939532538 Original CRISPR AGGCAAGGCATGATTCCTCC AGG (reversed) Intronic
No off target data available for this crispr