ID: 939532542

View in Genome Browser
Species Human (GRCh38)
Location 2:143382343-143382365
Sequence CTTGCCTCTCTGGTTTCTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939532536_939532542 3 Left 939532536 2:143382317-143382339 CCCACTGAAACCTGGAGGAATCA No data
Right 939532542 2:143382343-143382365 CTTGCCTCTCTGGTTTCTGGTGG No data
939532537_939532542 2 Left 939532537 2:143382318-143382340 CCACTGAAACCTGGAGGAATCAT No data
Right 939532542 2:143382343-143382365 CTTGCCTCTCTGGTTTCTGGTGG No data
939532538_939532542 -7 Left 939532538 2:143382327-143382349 CCTGGAGGAATCATGCCTTGCCT No data
Right 939532542 2:143382343-143382365 CTTGCCTCTCTGGTTTCTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939532542 Original CRISPR CTTGCCTCTCTGGTTTCTGG TGG Intronic
No off target data available for this crispr