ID: 939533817

View in Genome Browser
Species Human (GRCh38)
Location 2:143399461-143399483
Sequence ATTTTGCTTTGCTTATCTTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939533817_939533819 24 Left 939533817 2:143399461-143399483 CCATAAGATAAGCAAAGCAAAAT No data
Right 939533819 2:143399508-143399530 GCAACAAGGAACTAAGTTGCTGG No data
939533817_939533818 10 Left 939533817 2:143399461-143399483 CCATAAGATAAGCAAAGCAAAAT No data
Right 939533818 2:143399494-143399516 ACGATAATGATAAAGCAACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939533817 Original CRISPR ATTTTGCTTTGCTTATCTTA TGG (reversed) Intronic