ID: 939533819 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:143399508-143399530 |
| Sequence | GCAACAAGGAACTAAGTTGC TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 939533817_939533819 | 24 | Left | 939533817 | 2:143399461-143399483 | CCATAAGATAAGCAAAGCAAAAT | No data | ||
| Right | 939533819 | 2:143399508-143399530 | GCAACAAGGAACTAAGTTGCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 939533819 | Original CRISPR | GCAACAAGGAACTAAGTTGC TGG | Intronic | ||