ID: 939541894

View in Genome Browser
Species Human (GRCh38)
Location 2:143504575-143504597
Sequence AGCACAAATGTCCCAAGTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939541889_939541894 25 Left 939541889 2:143504527-143504549 CCAAAGCCCCTGCAGCTGTGGGA No data
Right 939541894 2:143504575-143504597 AGCACAAATGTCCCAAGTCATGG No data
939541890_939541894 19 Left 939541890 2:143504533-143504555 CCCCTGCAGCTGTGGGAATGAAC No data
Right 939541894 2:143504575-143504597 AGCACAAATGTCCCAAGTCATGG No data
939541891_939541894 18 Left 939541891 2:143504534-143504556 CCCTGCAGCTGTGGGAATGAACA No data
Right 939541894 2:143504575-143504597 AGCACAAATGTCCCAAGTCATGG No data
939541892_939541894 17 Left 939541892 2:143504535-143504557 CCTGCAGCTGTGGGAATGAACAG No data
Right 939541894 2:143504575-143504597 AGCACAAATGTCCCAAGTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939541894 Original CRISPR AGCACAAATGTCCCAAGTCA TGG Intronic
No off target data available for this crispr