ID: 939545437

View in Genome Browser
Species Human (GRCh38)
Location 2:143546570-143546592
Sequence AGATCTACACAGCAGTGGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939545437_939545442 -10 Left 939545437 2:143546570-143546592 CCACCCCACTGCTGTGTAGATCT No data
Right 939545442 2:143546583-143546605 GTGTAGATCTCAGGTTATGCTGG No data
939545437_939545444 23 Left 939545437 2:143546570-143546592 CCACCCCACTGCTGTGTAGATCT No data
Right 939545444 2:143546616-143546638 TGCAAACTACCAGATGATAATGG No data
939545437_939545443 -2 Left 939545437 2:143546570-143546592 CCACCCCACTGCTGTGTAGATCT No data
Right 939545443 2:143546591-143546613 CTCAGGTTATGCTGGTGTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939545437 Original CRISPR AGATCTACACAGCAGTGGGG TGG (reversed) Intronic
No off target data available for this crispr