ID: 939548797

View in Genome Browser
Species Human (GRCh38)
Location 2:143588020-143588042
Sequence CTGTTTGGAAAGAAGGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939548797_939548800 -9 Left 939548797 2:143588020-143588042 CCCTCTTCCTTCTTTCCAAACAG No data
Right 939548800 2:143588034-143588056 TCCAAACAGCTTATCAAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939548797 Original CRISPR CTGTTTGGAAAGAAGGAAGA GGG (reversed) Intronic
No off target data available for this crispr