ID: 939551509

View in Genome Browser
Species Human (GRCh38)
Location 2:143621355-143621377
Sequence AACCCTACCCTGGTGTTAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939551509_939551513 2 Left 939551509 2:143621355-143621377 CCTGTTAACACCAGGGTAGGGTT No data
Right 939551513 2:143621380-143621402 GGTTAGTTCATCTTGAGGACTGG No data
939551509_939551515 19 Left 939551509 2:143621355-143621377 CCTGTTAACACCAGGGTAGGGTT No data
Right 939551515 2:143621397-143621419 GACTGGTTGGCTTCATGAGAAGG No data
939551509_939551514 6 Left 939551509 2:143621355-143621377 CCTGTTAACACCAGGGTAGGGTT No data
Right 939551514 2:143621384-143621406 AGTTCATCTTGAGGACTGGTTGG No data
939551509_939551512 -3 Left 939551509 2:143621355-143621377 CCTGTTAACACCAGGGTAGGGTT No data
Right 939551512 2:143621375-143621397 GTTATGGTTAGTTCATCTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939551509 Original CRISPR AACCCTACCCTGGTGTTAAC AGG (reversed) Intronic
No off target data available for this crispr