ID: 939553129

View in Genome Browser
Species Human (GRCh38)
Location 2:143640284-143640306
Sequence ATGGGGAATCAGAAGGAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939553120_939553129 28 Left 939553120 2:143640233-143640255 CCTCCTAGAACAATCCATAGTAG No data
Right 939553129 2:143640284-143640306 ATGGGGAATCAGAAGGAAGAGGG No data
939553123_939553129 14 Left 939553123 2:143640247-143640269 CCATAGTAGTTAGGAGCAATGAT No data
Right 939553129 2:143640284-143640306 ATGGGGAATCAGAAGGAAGAGGG No data
939553121_939553129 25 Left 939553121 2:143640236-143640258 CCTAGAACAATCCATAGTAGTTA No data
Right 939553129 2:143640284-143640306 ATGGGGAATCAGAAGGAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939553129 Original CRISPR ATGGGGAATCAGAAGGAAGA GGG Intronic
No off target data available for this crispr