ID: 939564954

View in Genome Browser
Species Human (GRCh38)
Location 2:143775934-143775956
Sequence TGAACCCCCTGTGCATGGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939564949_939564954 -7 Left 939564949 2:143775918-143775940 CCAGTTAAATAGGCCCTGAACCC No data
Right 939564954 2:143775934-143775956 TGAACCCCCTGTGCATGGGCTGG No data
939564948_939564954 -1 Left 939564948 2:143775912-143775934 CCAGCACCAGTTAAATAGGCCCT No data
Right 939564954 2:143775934-143775956 TGAACCCCCTGTGCATGGGCTGG No data
939564946_939564954 1 Left 939564946 2:143775910-143775932 CCCCAGCACCAGTTAAATAGGCC No data
Right 939564954 2:143775934-143775956 TGAACCCCCTGTGCATGGGCTGG No data
939564947_939564954 0 Left 939564947 2:143775911-143775933 CCCAGCACCAGTTAAATAGGCCC No data
Right 939564954 2:143775934-143775956 TGAACCCCCTGTGCATGGGCTGG No data
939564944_939564954 9 Left 939564944 2:143775902-143775924 CCAGGTGTCCCCAGCACCAGTTA No data
Right 939564954 2:143775934-143775956 TGAACCCCCTGTGCATGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939564954 Original CRISPR TGAACCCCCTGTGCATGGGC TGG Intergenic
No off target data available for this crispr